Incidental Mutation 'R4903:Alg12'
ID377986
Institutional Source Beutler Lab
Gene Symbol Alg12
Ensembl Gene ENSMUSG00000035845
Gene Nameasparagine-linked glycosylation 12 (alpha-1,6-mannosyltransferase)
SynonymsECM39, mannosyltransferase
MMRRC Submission 042506-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location88805244-88819318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88814540 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 194 (I194N)
Ref Sequence ENSEMBL: ENSMUSP00000043480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043087] [ENSMUST00000159328] [ENSMUST00000162183]
Predicted Effect probably damaging
Transcript: ENSMUST00000043087
AA Change: I194N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043480
Gene: ENSMUSG00000035845
AA Change: I194N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 267 4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159328
SMART Domains Protein: ENSMUSP00000125534
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 169 6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160222
Predicted Effect possibly damaging
Transcript: ENSMUST00000162183
AA Change: I194N

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123935
Gene: ENSMUSG00000035845
AA Change: I194N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 406 3.3e-44 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 22 family. The encoded protein catalyzes the addition of the eighth mannose residue in an alpha-1,6 linkage onto the dolichol-PP-oligosaccharide precursor (dolichol-PP-Man(7)GlcNAc(2)) required for protein glycosylation. Mutations in this gene have been associated with congenital disorder of glycosylation type Ig (CDG-Ig)characterized by abnormal N-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Alg12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02557:Alg12 APN 15 88816207 nonsense probably null
R0077:Alg12 UTSW 15 88815978 missense probably damaging 1.00
R0365:Alg12 UTSW 15 88816149 missense possibly damaging 0.80
R0485:Alg12 UTSW 15 88811427 missense probably benign 0.00
R0726:Alg12 UTSW 15 88806647 missense probably damaging 1.00
R2064:Alg12 UTSW 15 88812115 missense probably damaging 1.00
R3404:Alg12 UTSW 15 88814579 missense probably damaging 0.98
R4567:Alg12 UTSW 15 88806353 intron probably benign
R4718:Alg12 UTSW 15 88806053 missense probably damaging 1.00
R4896:Alg12 UTSW 15 88816188 missense probably damaging 1.00
R5059:Alg12 UTSW 15 88811456 missense probably damaging 1.00
R7274:Alg12 UTSW 15 88806707 missense probably damaging 1.00
R8176:Alg12 UTSW 15 88805881 missense possibly damaging 0.82
R8358:Alg12 UTSW 15 88811300 missense probably null 0.01
R8445:Alg12 UTSW 15 88814486 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCCAGTCTTGGTTTGTG -3'
(R):5'- ACAGCTTCTAGAGTGTATGTATGTATT -3'

Sequencing Primer
(F):5'- GGTCATGGTATGTCCTCACAACAG -3'
(R):5'- GAAACCTGGGTCTTCTTCAAGGAC -3'
Posted On2016-04-15