Incidental Mutation 'R0304:Zfp871'
ID37800
Institutional Source Beutler Lab
Gene Symbol Zfp871
Ensembl Gene ENSMUSG00000024298
Gene Namezinc finger protein 871
Synonyms9030612M13Rik
MMRRC Submission 038515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0304 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32771236-32788287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32774434 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 589 (Y589C)
Ref Sequence ENSEMBL: ENSMUSP00000127178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057501] [ENSMUST00000159086]
Predicted Effect probably damaging
Transcript: ENSMUST00000057501
AA Change: Y570C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050501
Gene: ENSMUSG00000024298
AA Change: Y570C

DomainStartEndE-ValueType
KRAB 1 42 1.32e0 SMART
ZnF_C2H2 174 196 5.9e-3 SMART
ZnF_C2H2 202 224 6.32e-3 SMART
ZnF_C2H2 230 252 1.47e-3 SMART
ZnF_C2H2 258 280 3.63e-3 SMART
ZnF_C2H2 286 308 1.79e-2 SMART
ZnF_C2H2 314 336 4.79e-3 SMART
ZnF_C2H2 342 364 1.69e-3 SMART
ZnF_C2H2 370 392 2.79e-4 SMART
ZnF_C2H2 398 420 1.23e-5 SMART
ZnF_C2H2 426 448 1.2e-3 SMART
ZnF_C2H2 454 476 5.42e-2 SMART
ZnF_C2H2 482 504 8.6e-5 SMART
ZnF_C2H2 510 532 5.21e-4 SMART
ZnF_C2H2 538 560 3.11e-2 SMART
ZnF_C2H2 566 588 2.86e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159086
AA Change: Y589C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127178
Gene: ENSMUSG00000024298
AA Change: Y589C

DomainStartEndE-ValueType
KRAB 4 61 2.18e-15 SMART
ZnF_C2H2 193 215 5.9e-3 SMART
ZnF_C2H2 221 243 6.32e-3 SMART
ZnF_C2H2 249 271 1.47e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 1.79e-2 SMART
ZnF_C2H2 333 355 4.79e-3 SMART
ZnF_C2H2 361 383 1.69e-3 SMART
ZnF_C2H2 389 411 2.79e-4 SMART
ZnF_C2H2 417 439 1.23e-5 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 5.42e-2 SMART
ZnF_C2H2 501 523 8.6e-5 SMART
ZnF_C2H2 529 551 5.21e-4 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 2.86e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168337
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik C T 4: 144,520,049 T55I probably benign Het
Acod1 T A 14: 103,054,982 I314N probably damaging Het
Actl11 T A 9: 107,929,768 V430E probably damaging Het
Adam19 A C 11: 46,127,392 D427A possibly damaging Het
Adarb2 C T 13: 8,752,570 probably benign Het
Akap7 A T 10: 25,271,552 H93Q probably damaging Het
Ankrd36 C A 11: 5,628,981 R82S possibly damaging Het
Arhgap21 A T 2: 20,859,801 probably benign Het
Atm T A 9: 53,516,344 I489F probably benign Het
AU019823 T C 9: 50,607,922 D130G probably damaging Het
Carmil1 T C 13: 24,139,341 S243G probably damaging Het
Cdc42bpg T C 19: 6,317,248 V939A probably damaging Het
Cel A C 2: 28,557,771 L377R probably benign Het
Clock A G 5: 76,226,985 V779A unknown Het
Cluap1 G A 16: 3,929,918 probably benign Het
Ctif A T 18: 75,521,818 H212Q probably benign Het
Cyp4a29 T A 4: 115,252,932 probably benign Het
Cytip T C 2: 58,148,246 N101S possibly damaging Het
D130043K22Rik T C 13: 24,864,815 M434T probably benign Het
Ddx47 A G 6: 135,017,220 I154V possibly damaging Het
Dnah6 C T 6: 73,159,115 E1014K probably damaging Het
Dnajc27 T G 12: 4,106,793 probably benign Het
Drc7 A T 8: 95,059,128 D204V probably damaging Het
Dsc3 A G 18: 19,981,241 Y319H probably damaging Het
Eml6 T C 11: 29,777,441 Q1227R probably benign Het
Enpp2 A T 15: 54,877,806 D365E probably benign Het
Ercc2 T C 7: 19,386,708 I199T possibly damaging Het
Exd2 G A 12: 80,491,240 probably benign Het
F2 A T 2: 91,633,233 I128N probably damaging Het
Fam219b T C 9: 57,538,876 L123P probably damaging Het
Fasn A G 11: 120,819,936 V299A possibly damaging Het
Fastkd2 T C 1: 63,752,400 V689A possibly damaging Het
Fbxw13 C T 9: 109,194,721 R85Q probably benign Het
Fer1l6 A G 15: 58,590,562 Y822C probably benign Het
Fhl5 T C 4: 25,207,241 T176A probably benign Het
Gm20530 T G 17: 36,094,226 noncoding transcript Het
Gm4787 A T 12: 81,378,934 I150N probably damaging Het
Grip1 G A 10: 120,075,471 S618N probably benign Het
Hdac9 T C 12: 34,374,111 K454E probably damaging Het
Iars2 T A 1: 185,287,156 I978F possibly damaging Het
Icosl A G 10: 78,075,322 Y299C probably benign Het
Idi1 T C 13: 8,890,357 Y192H probably damaging Het
Iqub T G 6: 24,454,291 Q531P probably damaging Het
Itih4 T A 14: 30,890,094 probably null Het
Izumo4 A T 10: 80,702,936 H71L probably damaging Het
Jcad A T 18: 4,673,325 E362D possibly damaging Het
Kif21a G T 15: 90,976,521 probably null Het
Kynu A T 2: 43,679,881 I392F probably damaging Het
Luc7l2 A G 6: 38,592,776 E223G probably damaging Het
Map3k8 A C 18: 4,339,552 L273R probably damaging Het
Max A G 12: 76,938,587 L119P probably benign Het
Mphosph9 T C 5: 124,298,829 N484S probably benign Het
Mrgprg A G 7: 143,765,055 Y107H probably damaging Het
Mrps31 A T 8: 22,421,338 I199F probably benign Het
Mtr C G 13: 12,222,154 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nptx2 A G 5: 144,553,650 probably benign Het
Nrip1 T C 16: 76,292,707 Q654R possibly damaging Het
Ocm A G 5: 144,024,534 F30L probably damaging Het
Olfr1216 G A 2: 89,013,288 R259W probably damaging Het
Olfr1223 A C 2: 89,144,764 Y86* probably null Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Olfr600 G T 7: 103,346,711 D72E probably damaging Het
Oosp1 T C 19: 11,690,969 M17V probably benign Het
Pax1 A T 2: 147,366,147 Y225F probably benign Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pkd1 C A 17: 24,585,946 Q3190K probably damaging Het
Pkn1 A C 8: 83,683,607 probably benign Het
Plin5 T C 17: 56,115,597 D113G probably damaging Het
Ppfia1 A G 7: 144,482,345 V1141A probably damaging Het
Ppp4r1 T A 17: 65,816,006 D334E probably benign Het
Ptov1 A T 7: 44,863,449 probably null Het
Rab22a G A 2: 173,661,459 V22M probably damaging Het
Rictor T A 15: 6,786,371 probably null Het
Sart1 G T 19: 5,380,531 probably benign Het
Scn11a G A 9: 119,819,862 A45V probably benign Het
Serpina5 A G 12: 104,103,200 T224A possibly damaging Het
Siglecf G T 7: 43,352,401 G212C probably damaging Het
Slc38a4 A T 15: 97,008,454 M378K probably damaging Het
Spata22 T A 11: 73,340,449 C176* probably null Het
Tmc3 G A 7: 83,596,139 E131K probably damaging Het
Trappc10 A T 10: 78,210,760 probably benign Het
Uvrag A G 7: 98,887,973 F672L probably benign Het
Vmn1r121 A G 7: 21,098,407 V36A possibly damaging Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r58 C T 7: 5,410,496 C245Y probably damaging Het
Vmn1r86 C A 7: 13,102,780 M56I probably benign Het
Wdr62 T C 7: 30,242,874 Y1051C probably benign Het
Xpnpep3 A G 15: 81,430,714 D205G probably damaging Het
Zdhhc14 T C 17: 5,725,336 probably benign Het
Zfp607a A T 7: 27,879,212 D569V possibly damaging Het
Zfp609 C T 9: 65,701,188 E1137K possibly damaging Het
Zzef1 A T 11: 72,880,624 D1644V probably benign Het
Other mutations in Zfp871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp871 APN 17 32775899 missense probably benign
IGL00963:Zfp871 APN 17 32774752 missense probably benign 0.25
IGL01687:Zfp871 APN 17 32775644 missense probably benign 0.00
IGL02170:Zfp871 APN 17 32775688 missense possibly damaging 0.72
IGL02399:Zfp871 APN 17 32774355 missense probably benign 0.18
R1215:Zfp871 UTSW 17 32775972 missense possibly damaging 0.70
R1444:Zfp871 UTSW 17 32774926 missense possibly damaging 0.85
R1754:Zfp871 UTSW 17 32775334 missense probably damaging 1.00
R1913:Zfp871 UTSW 17 32775917 missense possibly damaging 0.53
R2018:Zfp871 UTSW 17 32774777 missense probably damaging 1.00
R2180:Zfp871 UTSW 17 32775301 missense probably damaging 1.00
R2881:Zfp871 UTSW 17 32775433 missense probably damaging 1.00
R4422:Zfp871 UTSW 17 32774833 missense probably benign 0.39
R4422:Zfp871 UTSW 17 32774834 missense probably benign 0.37
R4979:Zfp871 UTSW 17 32775855 missense probably damaging 0.99
R5564:Zfp871 UTSW 17 32775868 missense possibly damaging 0.70
R6228:Zfp871 UTSW 17 32775884 missense possibly damaging 0.50
R6232:Zfp871 UTSW 17 32775520 frame shift probably null
R6233:Zfp871 UTSW 17 32775520 frame shift probably null
R6234:Zfp871 UTSW 17 32775520 frame shift probably null
R6474:Zfp871 UTSW 17 32775673 missense possibly damaging 0.85
R7237:Zfp871 UTSW 17 32775315 missense probably damaging 1.00
R7809:Zfp871 UTSW 17 32774852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCCTCCAAGATCCAGGACTG -3'
(R):5'- TGAGAAGCCTTACGAGTGCAAGC -3'

Sequencing Primer
(F):5'- GACATCGCACGTTTGTTTCAATG -3'
(R):5'- CTTACGAGTGCAAGCAGTGTG -3'
Posted On2013-05-23