Incidental Mutation 'R4903:Lhcgr'
ID378000
Institutional Source Beutler Lab
Gene Symbol Lhcgr
Ensembl Gene ENSMUSG00000024107
Gene Nameluteinizing hormone/choriogonadotropin receptor
SynonymsLhr, LH-R, Gpcr19-rs1
MMRRC Submission 042506-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location88741549-88791976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88742361 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 579 (I579N)
Ref Sequence ENSEMBL: ENSMUSP00000024916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024916]
Predicted Effect probably damaging
Transcript: ENSMUST00000024916
AA Change: I579N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: I579N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 33 66 4.4e0 SMART
Pfam:LRR_5 155 273 2.9e-5 PFAM
Pfam:7tm_1 380 627 1.2e-29 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Lhcgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lhcgr APN 17 88742446 missense probably benign
IGL00661:Lhcgr APN 17 88750118 missense probably benign
IGL00840:Lhcgr APN 17 88753736 splice site probably benign
IGL01434:Lhcgr APN 17 88742437 missense probably damaging 1.00
IGL01489:Lhcgr APN 17 88764973 splice site probably benign
IGL02077:Lhcgr APN 17 88750130 missense probably benign 0.06
IGL02533:Lhcgr APN 17 88742410 missense probably benign 0.00
IGL02948:Lhcgr APN 17 88742622 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0556:Lhcgr UTSW 17 88772063 missense probably damaging 0.99
R1824:Lhcgr UTSW 17 88750157 missense probably benign 0.00
R1846:Lhcgr UTSW 17 88765147 critical splice donor site probably null
R1852:Lhcgr UTSW 17 88765176 missense probably damaging 0.99
R2352:Lhcgr UTSW 17 88742299 missense possibly damaging 0.52
R3147:Lhcgr UTSW 17 88758343 missense probably damaging 0.96
R3756:Lhcgr UTSW 17 88753856 missense possibly damaging 0.77
R4180:Lhcgr UTSW 17 88742283 missense probably damaging 1.00
R4540:Lhcgr UTSW 17 88755608 missense probably benign
R4688:Lhcgr UTSW 17 88765152 missense probably damaging 0.99
R4717:Lhcgr UTSW 17 88742467 missense probably benign 0.00
R4723:Lhcgr UTSW 17 88742602 missense probably benign 0.09
R4776:Lhcgr UTSW 17 88742697 missense probably damaging 1.00
R5195:Lhcgr UTSW 17 88742946 missense probably damaging 1.00
R5231:Lhcgr UTSW 17 88755611 missense probably damaging 1.00
R5361:Lhcgr UTSW 17 88742853 missense probably damaging 1.00
R5683:Lhcgr UTSW 17 88772019 missense probably benign 0.00
R5758:Lhcgr UTSW 17 88742548 missense probably damaging 0.99
R5929:Lhcgr UTSW 17 88743008 nonsense probably null
R5987:Lhcgr UTSW 17 88755578 missense probably damaging 1.00
R6268:Lhcgr UTSW 17 88742704 missense probably damaging 1.00
R6477:Lhcgr UTSW 17 88742373 missense probably damaging 1.00
R6610:Lhcgr UTSW 17 88769879 missense possibly damaging 0.93
R7234:Lhcgr UTSW 17 88791931 missense possibly damaging 0.96
R7282:Lhcgr UTSW 17 88758383 missense probably benign
R7320:Lhcgr UTSW 17 88742078 missense probably benign
R7398:Lhcgr UTSW 17 88772046 missense probably benign 0.03
R7710:Lhcgr UTSW 17 88742782 missense probably damaging 1.00
R8034:Lhcgr UTSW 17 88742356 missense probably damaging 1.00
U24488:Lhcgr UTSW 17 88772085 critical splice acceptor site probably null
X0028:Lhcgr UTSW 17 88742722 missense probably damaging 1.00
Z1176:Lhcgr UTSW 17 88742270 missense probably damaging 1.00
Z1177:Lhcgr UTSW 17 88753905 missense probably benign 0.00
Z1177:Lhcgr UTSW 17 88764981 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTAAAGTTCAGCCCGGTG -3'
(R):5'- TGGAATCCACTCTGTCACAAG -3'

Sequencing Primer
(F):5'- GAGAAAGAAATCTCTCTGAAATGCC -3'
(R):5'- TGGAATCCACTCTGTCACAAGTCTAC -3'
Posted On2016-04-15