Incidental Mutation 'R4903:Plcb3'
ID378005
Institutional Source Beutler Lab
Gene Symbol Plcb3
Ensembl Gene ENSMUSG00000024960
Gene Namephospholipase C, beta 3
Synonyms
MMRRC Submission 042506-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6953714-6969759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6955843 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 970 (R970L)
Ref Sequence ENSEMBL: ENSMUSP00000025912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025910] [ENSMUST00000025912] [ENSMUST00000113423] [ENSMUST00000113426]
Predicted Effect probably benign
Transcript: ENSMUST00000025910
SMART Domains Protein: ENSMUSP00000025910
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 204 5e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025912
AA Change: R970L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025912
Gene: ENSMUSG00000024960
AA Change: R970L

DomainStartEndE-ValueType
Pfam:EF-hand_like 225 316 6.6e-23 PFAM
PLCXc 317 468 4.26e-73 SMART
low complexity region 488 515 N/A INTRINSIC
low complexity region 553 578 N/A INTRINSIC
PLCYc 591 707 3.88e-76 SMART
C2 728 826 4.52e-14 SMART
low complexity region 917 936 N/A INTRINSIC
Pfam:PLC-beta_C 1029 1202 5.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113423
SMART Domains Protein: ENSMUSP00000109050
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 162 9.1e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113426
SMART Domains Protein: ENSMUSP00000109053
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 43 172 5.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141410
SMART Domains Protein: ENSMUSP00000114597
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 134 2.9e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145463
SMART Domains Protein: ENSMUSP00000121778
Gene: ENSMUSG00000024959

DomainStartEndE-ValueType
Pfam:Bcl-2_BAD 1 51 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphoinositide phospholipase C beta enzyme family that catalyze the production of the secondary messengers diacylglycerol and inositol 1,4,5-triphosphate from phosphatidylinositol in G-protein-linked receptor-mediated signal transduction. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one targeted mutation die at E2.5 and exhibit poor embryonic organization and hypocellularity. Mice homozygous for a second targeted mutation survive to adulthood and exhibit an increased antinocieptive response to opioids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trip11 A T 12: 101,886,806 probably null Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Plcb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Plcb3 APN 19 6955322 missense probably benign 0.27
IGL01370:Plcb3 APN 19 6962824 missense probably damaging 0.99
IGL01385:Plcb3 APN 19 6957908 missense probably benign
IGL01511:Plcb3 APN 19 6955843 missense probably damaging 0.99
IGL02182:Plcb3 APN 19 6969620 missense probably benign 0.22
IGL02240:Plcb3 APN 19 6958080 splice site probably benign
IGL02350:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02357:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02550:Plcb3 APN 19 6960176 nonsense probably null
IGL02866:Plcb3 APN 19 6957676 missense probably damaging 1.00
IGL03180:Plcb3 APN 19 6956153 missense probably benign 0.44
IGL03327:Plcb3 APN 19 6955052 missense probably benign
IGL03346:Plcb3 APN 19 6955052 missense probably benign
Multifarious UTSW 19 6954703 critical splice donor site probably null
R0042:Plcb3 UTSW 19 6966420 missense probably damaging 1.00
R0125:Plcb3 UTSW 19 6958908 missense probably damaging 1.00
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0724:Plcb3 UTSW 19 6963392 missense probably damaging 1.00
R0781:Plcb3 UTSW 19 6961913 nonsense probably null
R0945:Plcb3 UTSW 19 6954878 missense probably damaging 1.00
R1110:Plcb3 UTSW 19 6961913 nonsense probably null
R1414:Plcb3 UTSW 19 6963017 missense probably damaging 1.00
R1454:Plcb3 UTSW 19 6955046 missense possibly damaging 0.64
R1533:Plcb3 UTSW 19 6957673 missense possibly damaging 0.70
R1652:Plcb3 UTSW 19 6955296 missense probably benign 0.00
R1795:Plcb3 UTSW 19 6956013 unclassified probably benign
R1870:Plcb3 UTSW 19 6962985 missense probably benign 0.04
R1934:Plcb3 UTSW 19 6964609 missense probably damaging 1.00
R3980:Plcb3 UTSW 19 6966435 missense probably damaging 1.00
R4397:Plcb3 UTSW 19 6965825 missense probably damaging 0.96
R4533:Plcb3 UTSW 19 6956272 missense probably benign 0.08
R4576:Plcb3 UTSW 19 6959047 splice site probably benign
R4815:Plcb3 UTSW 19 6962984 missense possibly damaging 0.59
R5093:Plcb3 UTSW 19 6966210 missense probably damaging 1.00
R5555:Plcb3 UTSW 19 6966219 missense probably benign 0.19
R5593:Plcb3 UTSW 19 6954749 missense possibly damaging 0.94
R5626:Plcb3 UTSW 19 6955275 missense probably benign 0.24
R5661:Plcb3 UTSW 19 6963220 missense probably damaging 1.00
R5713:Plcb3 UTSW 19 6957692 missense probably damaging 0.99
R5741:Plcb3 UTSW 19 6954422 nonsense probably null
R6025:Plcb3 UTSW 19 6956179 missense probably benign 0.03
R6063:Plcb3 UTSW 19 6962834 missense possibly damaging 0.69
R6155:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6157:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6178:Plcb3 UTSW 19 6954703 critical splice donor site probably null
R7085:Plcb3 UTSW 19 6960133 missense possibly damaging 0.80
R7117:Plcb3 UTSW 19 6964378 missense probably damaging 1.00
R7134:Plcb3 UTSW 19 6965330 missense probably damaging 1.00
R7153:Plcb3 UTSW 19 6958084 critical splice donor site probably null
R7316:Plcb3 UTSW 19 6966385 critical splice donor site probably null
R7366:Plcb3 UTSW 19 6962021 missense probably benign
R7399:Plcb3 UTSW 19 6962867 missense probably benign
R7736:Plcb3 UTSW 19 6969623 missense probably benign 0.00
R8057:Plcb3 UTSW 19 6955095 missense probably benign
R8057:Plcb3 UTSW 19 6958899 missense probably damaging 0.99
R8376:Plcb3 UTSW 19 6966703 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATATTCCTGTCAGCACACAAC -3'
(R):5'- CAGGGCAGCGAGATGATTTG -3'

Sequencing Primer
(F):5'- TGTCAGCACACAACACAGGTG -3'
(R):5'- CGAGATGATTTGATTGCCAGCATCC -3'
Posted On2016-04-15