Incidental Mutation 'R4904:Coq8a'
ID378012
Institutional Source Beutler Lab
Gene Symbol Coq8a
Ensembl Gene ENSMUSG00000026489
Gene Namecoenzyme Q8A
Synonyms4632432J16Rik, Cabc1, Adck3
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180165238-180199602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180178603 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 207 (R207Q)
Ref Sequence ENSEMBL: ENSMUSP00000128290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027766] [ENSMUST00000159914] [ENSMUST00000160102] [ENSMUST00000160121] [ENSMUST00000160169] [ENSMUST00000160482] [ENSMUST00000160879] [ENSMUST00000161300] [ENSMUST00000161379] [ENSMUST00000161632] [ENSMUST00000161743] [ENSMUST00000161746] [ENSMUST00000161814] [ENSMUST00000162725] [ENSMUST00000162769] [ENSMUST00000170472]
Predicted Effect probably damaging
Transcript: ENSMUST00000027766
AA Change: R207Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027766
Gene: ENSMUSG00000026489
AA Change: R207Q

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159591
Predicted Effect probably benign
Transcript: ENSMUST00000159914
SMART Domains Protein: ENSMUSP00000123720
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160102
SMART Domains Protein: ENSMUSP00000124289
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160121
SMART Domains Protein: ENSMUSP00000124208
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160169
SMART Domains Protein: ENSMUSP00000125089
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160482
SMART Domains Protein: ENSMUSP00000124329
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160879
SMART Domains Protein: ENSMUSP00000141948
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161300
AA Change: R10Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125002
Gene: ENSMUSG00000026489
AA Change: R10Q

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:ABC1 93 187 5.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161379
Predicted Effect probably benign
Transcript: ENSMUST00000161632
SMART Domains Protein: ENSMUSP00000124481
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 44 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161743
SMART Domains Protein: ENSMUSP00000123905
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161746
Predicted Effect probably benign
Transcript: ENSMUST00000161814
SMART Domains Protein: ENSMUSP00000125071
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162725
SMART Domains Protein: ENSMUSP00000125024
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162769
Predicted Effect probably damaging
Transcript: ENSMUST00000170472
AA Change: R207Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128290
Gene: ENSMUSG00000026489
AA Change: R207Q

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.1e-35 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Coq8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Coq8a APN 1 180168389 missense probably benign 0.11
IGL01797:Coq8a APN 1 180169719 splice site probably null
IGL01873:Coq8a APN 1 180178977 missense probably damaging 1.00
R1148:Coq8a UTSW 1 180169403 splice site probably benign
R1421:Coq8a UTSW 1 180170441 splice site probably benign
R1743:Coq8a UTSW 1 180182229 missense probably benign 0.14
R4678:Coq8a UTSW 1 180170081 missense probably damaging 0.99
R4827:Coq8a UTSW 1 180167338 missense possibly damaging 0.46
R5716:Coq8a UTSW 1 180179260 missense possibly damaging 0.94
R5769:Coq8a UTSW 1 180179116 missense probably damaging 1.00
R6636:Coq8a UTSW 1 180178987 missense probably benign 0.00
R6991:Coq8a UTSW 1 180179068 missense probably benign 0.00
R7125:Coq8a UTSW 1 180168801 missense probably damaging 1.00
R7158:Coq8a UTSW 1 180179184 missense probably benign 0.00
R7161:Coq8a UTSW 1 180170341 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTCAGCAGCTACTTCATGGG -3'
(R):5'- AACCTCCCATGCTGTGACTTTAG -3'

Sequencing Primer
(F):5'- GCAACATGGCCATATACCACC -3'
(R):5'- CCCATGCTGTGACTTTAGAAATACC -3'
Posted On2016-04-15