Incidental Mutation 'R0304:Plin5'
ID 37802
Institutional Source Beutler Lab
Gene Symbol Plin5
Ensembl Gene ENSMUSG00000011305
Gene Name perilipin 5
Synonyms Lsdp5, MLDP, 2310076L09Rik
MMRRC Submission 038515-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.168) question?
Stock # R0304 (G1)
Quality Score 125
Status Validated
Chromosome 17
Chromosomal Location 56418601-56424596 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56422597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000108695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019808] [ENSMUST00000041357] [ENSMUST00000113072]
AlphaFold Q8BVZ1
Predicted Effect probably damaging
Transcript: ENSMUST00000019808
AA Change: D113G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019808
Gene: ENSMUSG00000011305
AA Change: D113G

DomainStartEndE-ValueType
Pfam:Perilipin 31 383 1.2e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041357
SMART Domains Protein: ENSMUSP00000038048
Gene: ENSMUSG00000037095

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRR 84 107 1.86e0 SMART
LRR_TYP 108 131 3.63e-3 SMART
LRR 133 155 5.89e1 SMART
LRR_TYP 156 179 1.45e-2 SMART
LRR_TYP 180 203 8.47e-4 SMART
LRR 205 227 2.08e1 SMART
LRR 229 251 1.91e1 SMART
LRR 252 275 5.34e-1 SMART
LRRCT 292 342 9.69e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113072
AA Change: D113G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108695
Gene: ENSMUSG00000011305
AA Change: D113G

DomainStartEndE-ValueType
Pfam:Perilipin 27 384 2.3e-128 PFAM
Meta Mutation Damage Score 0.6288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN5, coat intracellular lipid storage droplets and protect them from lipolytic degradation (Dalen et al., 2007 [PubMed 17234449]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit excessive fatty acid oxidation, abnormal lipid levels in organs depending on fed or fasted state, increased oxygen consumption and activity in the dark phase, and decreased cardiac muscle contractility in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 C T 4: 144,246,619 (GRCm39) T55I probably benign Het
Acod1 T A 14: 103,292,418 (GRCm39) I314N probably damaging Het
Actl11 T A 9: 107,806,967 (GRCm39) V430E probably damaging Het
Adam19 A C 11: 46,018,219 (GRCm39) D427A possibly damaging Het
Adarb2 C T 13: 8,802,606 (GRCm39) probably benign Het
Akap7 A T 10: 25,147,450 (GRCm39) H93Q probably damaging Het
Ankrd36 C A 11: 5,578,981 (GRCm39) R82S possibly damaging Het
Arhgap21 A T 2: 20,864,612 (GRCm39) probably benign Het
Atm T A 9: 53,427,644 (GRCm39) I489F probably benign Het
Carmil1 T C 13: 24,323,324 (GRCm39) S243G probably damaging Het
Cdc42bpg T C 19: 6,367,278 (GRCm39) V939A probably damaging Het
Cel A C 2: 28,447,783 (GRCm39) L377R probably benign Het
Clock A G 5: 76,374,832 (GRCm39) V779A unknown Het
Cluap1 G A 16: 3,747,782 (GRCm39) probably benign Het
Ctif A T 18: 75,654,889 (GRCm39) H212Q probably benign Het
Cyp4a29 T A 4: 115,110,129 (GRCm39) probably benign Het
Cytip T C 2: 58,038,258 (GRCm39) N101S possibly damaging Het
D130043K22Rik T C 13: 25,048,798 (GRCm39) M434T probably benign Het
Ddx47 A G 6: 134,994,183 (GRCm39) I154V possibly damaging Het
Dnah6 C T 6: 73,136,098 (GRCm39) E1014K probably damaging Het
Dnajc27 T G 12: 4,156,793 (GRCm39) probably benign Het
Drc7 A T 8: 95,785,756 (GRCm39) D204V probably damaging Het
Dsc3 A G 18: 20,114,298 (GRCm39) Y319H probably damaging Het
Eml6 T C 11: 29,727,441 (GRCm39) Q1227R probably benign Het
Enpp2 A T 15: 54,741,202 (GRCm39) D365E probably benign Het
Ercc2 T C 7: 19,120,633 (GRCm39) I199T possibly damaging Het
Exd2 G A 12: 80,538,014 (GRCm39) probably benign Het
F2 A T 2: 91,463,578 (GRCm39) I128N probably damaging Het
Fam219b T C 9: 57,446,159 (GRCm39) L123P probably damaging Het
Fasn A G 11: 120,710,762 (GRCm39) V299A possibly damaging Het
Fastkd2 T C 1: 63,791,559 (GRCm39) V689A possibly damaging Het
Fbxw13 C T 9: 109,023,789 (GRCm39) R85Q probably benign Het
Fer1l6 A G 15: 58,462,411 (GRCm39) Y822C probably benign Het
Fhl5 T C 4: 25,207,241 (GRCm39) T176A probably benign Het
Gm20530 T G 17: 36,405,118 (GRCm39) noncoding transcript Het
Gm4787 A T 12: 81,425,708 (GRCm39) I150N probably damaging Het
Grip1 G A 10: 119,911,376 (GRCm39) S618N probably benign Het
Hdac9 T C 12: 34,424,110 (GRCm39) K454E probably damaging Het
Iars2 T A 1: 185,019,353 (GRCm39) I978F possibly damaging Het
Icosl A G 10: 77,911,156 (GRCm39) Y299C probably benign Het
Idi1 T C 13: 8,940,393 (GRCm39) Y192H probably damaging Het
Iqub T G 6: 24,454,290 (GRCm39) Q531P probably damaging Het
Itih4 T A 14: 30,612,051 (GRCm39) probably null Het
Izumo4 A T 10: 80,538,770 (GRCm39) H71L probably damaging Het
Jcad A T 18: 4,673,325 (GRCm39) E362D possibly damaging Het
Kif21a G T 15: 90,860,724 (GRCm39) probably null Het
Kynu A T 2: 43,569,893 (GRCm39) I392F probably damaging Het
Luc7l2 A G 6: 38,569,711 (GRCm39) E223G probably damaging Het
Map3k8 A C 18: 4,339,552 (GRCm39) L273R probably damaging Het
Max A G 12: 76,985,361 (GRCm39) L119P probably benign Het
Mphosph9 T C 5: 124,436,892 (GRCm39) N484S probably benign Het
Mrgprg A G 7: 143,318,792 (GRCm39) Y107H probably damaging Het
Mrps31 A T 8: 22,911,354 (GRCm39) I199F probably benign Het
Mtr C G 13: 12,237,040 (GRCm39) probably null Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Nkapd1 T C 9: 50,519,222 (GRCm39) D130G probably damaging Het
Nptx2 A G 5: 144,490,460 (GRCm39) probably benign Het
Nrip1 T C 16: 76,089,595 (GRCm39) Q654R possibly damaging Het
Ocm A G 5: 143,961,352 (GRCm39) F30L probably damaging Het
Oosp1 T C 19: 11,668,333 (GRCm39) M17V probably benign Het
Or14c45 C T 7: 86,176,195 (GRCm39) P77S probably damaging Het
Or4c111 G A 2: 88,843,632 (GRCm39) R259W probably damaging Het
Or4c118 A C 2: 88,975,108 (GRCm39) Y86* probably null Het
Or52ad1 G T 7: 102,995,918 (GRCm39) D72E probably damaging Het
Pax1 A T 2: 147,208,067 (GRCm39) Y225F probably benign Het
Pde4dip T A 3: 97,751,028 (GRCm39) H62L probably benign Het
Pkd1 C A 17: 24,804,920 (GRCm39) Q3190K probably damaging Het
Pkn1 A C 8: 84,410,236 (GRCm39) probably benign Het
Ppfia1 A G 7: 144,036,082 (GRCm39) V1141A probably damaging Het
Ppp4r1 T A 17: 66,123,001 (GRCm39) D334E probably benign Het
Ptov1 A T 7: 44,512,873 (GRCm39) probably null Het
Rab22a G A 2: 173,503,252 (GRCm39) V22M probably damaging Het
Rictor T A 15: 6,815,852 (GRCm39) probably null Het
Sart1 G T 19: 5,430,559 (GRCm39) probably benign Het
Scn11a G A 9: 119,648,928 (GRCm39) A45V probably benign Het
Serpina5 A G 12: 104,069,459 (GRCm39) T224A possibly damaging Het
Siglecf G T 7: 43,001,825 (GRCm39) G212C probably damaging Het
Slc38a4 A T 15: 96,906,335 (GRCm39) M378K probably damaging Het
Spata22 T A 11: 73,231,275 (GRCm39) C176* probably null Het
Tmc3 G A 7: 83,245,347 (GRCm39) E131K probably damaging Het
Trappc10 A T 10: 78,046,594 (GRCm39) probably benign Het
Uvrag A G 7: 98,537,180 (GRCm39) F672L probably benign Het
Vmn1r121 A G 7: 20,832,332 (GRCm39) V36A possibly damaging Het
Vmn1r13 A T 6: 57,187,611 (GRCm39) M257L probably benign Het
Vmn1r58 C T 7: 5,413,495 (GRCm39) C245Y probably damaging Het
Vmn1r86 C A 7: 12,836,707 (GRCm39) M56I probably benign Het
Wdr62 T C 7: 29,942,299 (GRCm39) Y1051C probably benign Het
Xpnpep3 A G 15: 81,314,915 (GRCm39) D205G probably damaging Het
Zdhhc14 T C 17: 5,775,611 (GRCm39) probably benign Het
Zfp607a A T 7: 27,578,637 (GRCm39) D569V possibly damaging Het
Zfp609 C T 9: 65,608,470 (GRCm39) E1137K possibly damaging Het
Zfp871 T C 17: 32,993,408 (GRCm39) Y589C probably damaging Het
Zzef1 A T 11: 72,771,450 (GRCm39) D1644V probably benign Het
Other mutations in Plin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0981:Plin5 UTSW 17 56,421,020 (GRCm39) missense probably damaging 1.00
R1966:Plin5 UTSW 17 56,419,186 (GRCm39) missense probably damaging 1.00
R2153:Plin5 UTSW 17 56,423,836 (GRCm39) missense probably benign 0.02
R2368:Plin5 UTSW 17 56,422,588 (GRCm39) missense probably damaging 1.00
R4809:Plin5 UTSW 17 56,423,855 (GRCm39) missense probably benign 0.00
R5173:Plin5 UTSW 17 56,422,548 (GRCm39) splice site probably null
R5315:Plin5 UTSW 17 56,421,066 (GRCm39) missense probably benign 0.15
R5836:Plin5 UTSW 17 56,422,549 (GRCm39) critical splice donor site probably null
R7129:Plin5 UTSW 17 56,422,174 (GRCm39) missense probably null
R7510:Plin5 UTSW 17 56,420,975 (GRCm39) missense probably damaging 0.97
R8305:Plin5 UTSW 17 56,422,221 (GRCm39) missense probably benign 0.00
R9190:Plin5 UTSW 17 56,419,462 (GRCm39) missense probably damaging 1.00
R9248:Plin5 UTSW 17 56,419,324 (GRCm39) missense probably damaging 0.99
R9723:Plin5 UTSW 17 56,423,290 (GRCm39) missense probably damaging 1.00
X0028:Plin5 UTSW 17 56,423,324 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGAGCCAATGCCCAACCTATTTG -3'
(R):5'- AAACCCTTGACTGACTGTGTGACTG -3'

Sequencing Primer
(F):5'- GATACATCATACATGCCTGATTCC -3'
(R):5'- AGACTCTGAGTCCGGTTGAAC -3'
Posted On 2013-05-23