Mutagenetix > Incidental Mutations

Incidental Mutation 'R4904:Tcaf3'

378029

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

042507-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R4904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 42593997 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 274 (E274*)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]

Predicted Effect

probably null
Transcript: ENSMUST00000069023
AA Change: E274*

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: E274*

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134707

SMART Domains

Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
low complexity region	210	221	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.1%

Validation Efficiency

94% (82/87)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb2	T	G	4: 130,012,539	I920S	possibly damaging	Het
Afap1l1	A	G	18: 61,738,715	I556T	probably benign	Het
Ankfy1	C	A	11: 72,752,105	H665N	probably benign	Het
Aqp9	A	C	9: 71,162,403		probably benign	Het
Arhgap21	A	G	2: 20,850,061	S1497P	probably benign	Het
Armc7	A	G	11: 115,488,974	D166G	probably damaging	Het
Arrdc1	C	A	2: 24,926,664	V167F	possibly damaging	Het
AW822073	T	A	10: 58,223,487	R482*	probably null	Het
Col6a3	A	T	1: 90,801,442	I1259N	probably damaging	Het
Coq8a	C	T	1: 180,178,603	R207Q	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dcbld1	C	T	10: 52,319,970	Q425*	probably null	Het
Def8	A	G	8: 123,461,480	N445D	probably damaging	Het
Dicer1	C	T	12: 104,713,066	V551I	probably benign	Het
Dst	A	T	1: 34,169,798	T800S	probably damaging	Het
Dtl	A	T	1: 191,568,345	C136S	probably damaging	Het
Duox1	T	A	2: 122,320,864	Y310N	probably damaging	Het
Ebf1	T	C	11: 44,869,169	F211S	probably damaging	Het
Gm44501	A	T	17: 40,578,993	I133F	possibly damaging	Het
Gm6625	T	C	8: 89,146,751		noncoding transcript	Het
Golgb1	A	T	16: 36,893,386	D243V	probably damaging	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Gtf2a1l	G	A	17: 88,690,043		probably null	Het
Herc2	T	C	7: 56,157,486	F2471L	probably damaging	Het
Hfe	A	T	13: 23,708,054	I109N	probably damaging	Het
Hrg	A	G	16: 22,951,250	E43G	probably benign	Het
Hspa1a	T	C	17: 34,970,451	D492G	probably damaging	Het
Itgb8	T	C	12: 119,170,871	D487G	probably benign	Het
Jag1	A	G	2: 137,087,142	V798A	probably damaging	Het
Kcnq5	A	G	1: 21,424,100	V501A	probably damaging	Het
Kntc1	T	C	5: 123,778,333	V743A	possibly damaging	Het
Ly86	G	T	13: 37,415,520	V126F	possibly damaging	Het
Med26	A	T	8: 72,496,847	L136H	probably damaging	Het
Mpp3	T	C	11: 102,000,587	D575G	probably benign	Het
Myoc	G	A	1: 162,639,425	M54I	probably benign	Het
Nlrp1c-ps	A	G	11: 71,242,628		noncoding transcript	Het
Olfr111	A	G	17: 37,530,631	Y218C	probably damaging	Het
Olfr1418	C	T	19: 11,855,867	V29M	possibly damaging	Het
Olfr574	A	G	7: 102,949,065	Y190C	probably damaging	Het
Pak7	A	T	2: 136,083,347	D678E	probably benign	Het
Pcdhb12	T	C	18: 37,437,856	V685A	possibly damaging	Het
Pcdhga2	A	G	18: 37,669,879	T259A	possibly damaging	Het
Pde6a	A	T	18: 61,265,034	M702L	probably benign	Het
Pigq	A	G	17: 25,931,060		probably benign	Het
Polrmt	A	G	10: 79,746,551	M1T	probably null	Het
Ptch1	A	C	13: 63,523,004	I904S	probably damaging	Het
Rflnb	A	T	11: 76,022,138	C141*	probably null	Het
Rilpl1	C	A	5: 124,514,744		probably null	Het
Rpgrip1	T	C	14: 52,121,087	S217P	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,129	I1292F	probably damaging	Het
Sema3a	A	C	5: 13,581,098	Y534S	probably damaging	Het
Sez6	A	G	11: 77,975,254	Y736C	probably damaging	Het
Shank1	G	T	7: 44,334,040		probably benign	Het
Slc45a4	G	A	15: 73,586,842	S294F	probably benign	Het
Slc9a8	A	G	2: 167,471,396	I393V	possibly damaging	Het
Sod1	T	A	16: 90,222,844	F46Y	probably damaging	Het
Sult1b1	T	C	5: 87,535,053	D11G	probably benign	Het
Syn3	T	G	10: 86,467,086	K68N	possibly damaging	Het
Taar8c	C	T	10: 24,101,249	V222I	probably benign	Het
Tbx20	T	C	9: 24,758,833	K235E	probably damaging	Het
Tll1	A	T	8: 64,070,199	M493K	probably benign	Het
Tmem236	T	A	2: 14,195,992	S123T	probably benign	Het
Trim33	T	C	3: 103,331,647	V647A	possibly damaging	Het
Tspear	T	A	10: 77,869,655	Y296N	possibly damaging	Het
Vps13d	T	C	4: 145,155,445	K1187E	probably damaging	Het
Xpot	C	T	10: 121,617,178	V52I	probably benign	Het
Zdhhc3	A	T	9: 123,100,387	V61E	probably damaging	Het
Zfp955a	A	T	17: 33,242,188	C323*	probably null	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TATATTGGCGAGTGAGCAGCAG -3'
(R):5'- TTCCAGGTGTGAGGATGAGC -3'

Sequencing Primer
(F):5'- AACACGCTCAAGTCACTGGTTAG -3'
(R):5'- ATGAGCTCGAGGACGACC -3'

Posted On

2016-04-15