Incidental Mutation 'R4904:Tll1'
ID378034
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Nametolloid-like
SynonymsTll-1
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location64014931-64206271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64070199 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 493 (M493K)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
Predicted Effect probably benign
Transcript: ENSMUST00000066166
AA Change: M493K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: M493K

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64016136 missense probably benign
IGL00583:Tll1 APN 8 64205292 missense probably benign
IGL00767:Tll1 APN 8 64071321 missense probably damaging 1.00
IGL01061:Tll1 APN 8 64038454 critical splice donor site probably null
IGL01077:Tll1 APN 8 64070232 missense probably benign 0.27
IGL01536:Tll1 APN 8 64074289 missense probably damaging 1.00
IGL02137:Tll1 APN 8 64016098 missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64053967 missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64017626 nonsense probably null
IGL02469:Tll1 APN 8 64070280 missense probably benign 0.41
IGL02504:Tll1 APN 8 64070237 missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64046997 splice site probably benign
IGL02937:Tll1 APN 8 64205285 nonsense probably null
IGL03006:Tll1 APN 8 64074217 splice site probably benign
R0518:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0521:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0541:Tll1 UTSW 8 64038452 splice site probably null
R0612:Tll1 UTSW 8 64071310 missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64074290 missense probably damaging 0.99
R0738:Tll1 UTSW 8 64101950 missense probably damaging 1.00
R1454:Tll1 UTSW 8 64038490 missense probably benign
R1619:Tll1 UTSW 8 64056273 missense probably benign 0.25
R1625:Tll1 UTSW 8 64041442 missense probably damaging 1.00
R1654:Tll1 UTSW 8 64117903 critical splice donor site probably null
R1663:Tll1 UTSW 8 64017686 missense probably benign 0.08
R1681:Tll1 UTSW 8 64085551 missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64101873 missense probably damaging 0.99
R1908:Tll1 UTSW 8 64025107 missense probably damaging 0.98
R2118:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2121:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2124:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2360:Tll1 UTSW 8 64051401 missense probably damaging 1.00
R2396:Tll1 UTSW 8 64070290 nonsense probably null
R3032:Tll1 UTSW 8 64098492 missense probably damaging 0.96
R3115:Tll1 UTSW 8 64053866 missense probably damaging 1.00
R3889:Tll1 UTSW 8 64205224 missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64118014 missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64041511 missense probably damaging 1.00
R4572:Tll1 UTSW 8 64056309 missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64051377 missense probably benign 0.31
R4811:Tll1 UTSW 8 64085473 missense possibly damaging 0.72
R4992:Tll1 UTSW 8 64093944 missense probably damaging 0.98
R5061:Tll1 UTSW 8 64053949 missense probably damaging 0.99
R5078:Tll1 UTSW 8 64093887 missense probably damaging 1.00
R5208:Tll1 UTSW 8 64051493 missense probably damaging 0.99
R5283:Tll1 UTSW 8 64101966 missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64085488 missense probably damaging 1.00
R5699:Tll1 UTSW 8 64117940 missense probably damaging 0.98
R5986:Tll1 UTSW 8 64074263 missense probably damaging 0.99
R6019:Tll1 UTSW 8 64041491 missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64053891 nonsense probably null
R6083:Tll1 UTSW 8 64038586 splice site probably null
R6125:Tll1 UTSW 8 64051487 missense probably damaging 1.00
R6222:Tll1 UTSW 8 64098534 missense probably benign 0.18
R6275:Tll1 UTSW 8 64051367 nonsense probably null
R6508:Tll1 UTSW 8 64098460 missense probably damaging 0.99
R6758:Tll1 UTSW 8 64041405 critical splice donor site probably null
R6782:Tll1 UTSW 8 64071281 missense probably benign 0.00
R6848:Tll1 UTSW 8 64098510 missense probably damaging 0.99
R7057:Tll1 UTSW 8 64101881 missense probably damaging 1.00
R7144:Tll1 UTSW 8 64124945 missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64025188 missense probably benign 0.00
R7336:Tll1 UTSW 8 64025142 missense probably damaging 0.98
R7373:Tll1 UTSW 8 64051357 missense probably damaging 0.98
R7626:Tll1 UTSW 8 64098234 intron probably null
R7687:Tll1 UTSW 8 64121492 nonsense probably null
R7699:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7700:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7765:Tll1 UTSW 8 64051449 missense probably damaging 1.00
R7790:Tll1 UTSW 8 64025237 nonsense probably null
X0020:Tll1 UTSW 8 64017628 missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64047163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTTACACTTTATAGGCTACC -3'
(R):5'- GGCACAGTCTTTGCATTCTCATAG -3'

Sequencing Primer
(F):5'- CCTCTGCTTCTTCGATGATTAAAAGG -3'
(R):5'- GTCTTTGCATTCTCATAGAACTGAC -3'
Posted On2016-04-15