Incidental Mutation 'R4904:Def8'
ID378037
Institutional Source Beutler Lab
Gene Symbol Def8
Ensembl Gene ENSMUSG00000001482
Gene Namedifferentially expressed in FDCP 8
SynonymsD8Ertd713e
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R4904 (G1)
Quality Score218
Status Validated
Chromosome8
Chromosomal Location123423527-123463270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123461480 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 445 (N445D)
Ref Sequence ENSEMBL: ENSMUSP00000104460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001522] [ENSMUST00000065534] [ENSMUST00000093049] [ENSMUST00000108830] [ENSMUST00000108832] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000001522
AA Change: N433D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001522
Gene: ENSMUSG00000001482
AA Change: N433D

DomainStartEndE-ValueType
Blast:DUF4206 77 133 8e-28 BLAST
C1 148 198 4.12e-3 SMART
DUF4206 243 447 4.01e-121 SMART
C1 385 437 1.5e0 SMART
RING 399 440 4.86e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065534
AA Change: N421D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070579
Gene: ENSMUSG00000001482
AA Change: N421D

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093049
SMART Domains Protein: ENSMUSP00000090737
Gene: ENSMUSG00000001482

DomainStartEndE-ValueType
Blast:DUF4206 65 121 9e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 429 6.85e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108830
AA Change: N421D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104458
Gene: ENSMUSG00000001482
AA Change: N421D

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108832
AA Change: N445D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104460
Gene: ENSMUSG00000001482
AA Change: N445D

DomainStartEndE-ValueType
Blast:DUF4206 89 145 9e-28 BLAST
C1 160 210 4.12e-3 SMART
DUF4206 255 459 4.01e-121 SMART
C1 397 449 1.5e0 SMART
RING 411 452 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.1802 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Def8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Def8 APN 8 123459650 missense possibly damaging 0.95
IGL01896:Def8 APN 8 123459895 missense probably benign 0.29
IGL02424:Def8 APN 8 123459648 missense possibly damaging 0.65
IGL02982:Def8 APN 8 123456539 unclassified probably benign
IGL03218:Def8 APN 8 123456436 missense probably damaging 1.00
defensive UTSW 8 123454322 missense probably damaging 1.00
PIT4495001:Def8 UTSW 8 123459553 missense probably benign 0.00
R0003:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0117:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0119:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0135:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0138:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0141:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0408:Def8 UTSW 8 123459917 missense probably damaging 1.00
R0636:Def8 UTSW 8 123454357 nonsense probably null
R3890:Def8 UTSW 8 123458344 unclassified probably benign
R3891:Def8 UTSW 8 123458344 unclassified probably benign
R3892:Def8 UTSW 8 123458344 unclassified probably benign
R5930:Def8 UTSW 8 123460070 unclassified probably benign
R6088:Def8 UTSW 8 123460048 nonsense probably null
R6577:Def8 UTSW 8 123456710 missense probably benign 0.01
R7446:Def8 UTSW 8 123454322 missense probably damaging 1.00
R7498:Def8 UTSW 8 123447844 missense probably damaging 1.00
R7770:Def8 UTSW 8 123460059 missense unknown
R7827:Def8 UTSW 8 123447321 missense probably benign
Z1088:Def8 UTSW 8 123456498 missense probably damaging 0.96
Z1176:Def8 UTSW 8 123459966 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TTGACAAGAGCTTGGGTATGAG -3'
(R):5'- TCCAGAGTAGAATGCACATCTGG -3'

Sequencing Primer
(F):5'- CTCGTTAGGAGAAGCCAGC -3'
(R):5'- ACATCTGGTGGGCAAGGC -3'
Posted On2016-04-15