Incidental Mutation 'R4904:Syn3'
ID378045
Institutional Source Beutler Lab
Gene Symbol Syn3
Ensembl Gene ENSMUSG00000059602
Gene Namesynapsin III
SynonymsSynapsin IIIa
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86055125-86498896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86467086 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 68 (K68N)
Ref Sequence ENSEMBL: ENSMUSP00000113408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120638] [ENSMUST00000121789]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120638
AA Change: K68N

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113720
Gene: ENSMUSG00000059602
AA Change: K68N

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 8.7e-22 PFAM
low complexity region 47 66 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
Pfam:Synapsin 89 190 1.8e-46 PFAM
Pfam:Synapsin_C 192 394 6.8e-141 PFAM
low complexity region 418 485 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121789
AA Change: K68N

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113408
Gene: ENSMUSG00000059602
AA Change: K68N

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 2.2e-25 PFAM
low complexity region 47 66 N/A INTRINSIC
Pfam:Synapsin 87 190 3.6e-63 PFAM
Pfam:Synapsin_C 192 242 6.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145864
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display altered neurotransmitter release, reduced synaptic depression, and a specific delay in early axon outgrowth in cultured hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Syn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Syn3 APN 10 86354416 missense probably damaging 1.00
IGL02391:Syn3 APN 10 86064906 missense probably benign 0.22
IGL02598:Syn3 APN 10 86467199 missense probably damaging 0.99
IGL03007:Syn3 APN 10 86064914 missense possibly damaging 0.57
IGL03379:Syn3 APN 10 86064872 missense possibly damaging 0.80
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R1577:Syn3 UTSW 10 86448864 critical splice donor site probably null
R1597:Syn3 UTSW 10 86135044 missense probably benign 0.16
R1699:Syn3 UTSW 10 86080211 missense probably damaging 1.00
R1916:Syn3 UTSW 10 86354344 critical splice donor site probably null
R2006:Syn3 UTSW 10 86073233 missense probably benign 0.20
R2025:Syn3 UTSW 10 86466982 missense probably damaging 0.97
R4413:Syn3 UTSW 10 86055592 unclassified probably benign
R5050:Syn3 UTSW 10 86407668 missense probably benign 0.05
R5286:Syn3 UTSW 10 86351564 missense possibly damaging 0.93
R5449:Syn3 UTSW 10 86351570 missense probably damaging 1.00
R5507:Syn3 UTSW 10 86080226 missense probably benign 0.01
R5792:Syn3 UTSW 10 86294628 makesense probably null
R6525:Syn3 UTSW 10 86467052 missense probably damaging 0.99
R6605:Syn3 UTSW 10 86057564 missense unknown
R7000:Syn3 UTSW 10 86080252 missense probably damaging 1.00
R7619:Syn3 UTSW 10 86057564 missense unknown
R7661:Syn3 UTSW 10 86069076 missense probably damaging 1.00
R7710:Syn3 UTSW 10 86407670 missense probably damaging 0.98
R7730:Syn3 UTSW 10 86448909 missense probably benign 0.05
R7798:Syn3 UTSW 10 86080253 missense probably damaging 1.00
R7819:Syn3 UTSW 10 86055540 unclassified probably benign
R7899:Syn3 UTSW 10 86064929 missense possibly damaging 0.94
R8248:Syn3 UTSW 10 86135021 missense probably benign 0.13
X0023:Syn3 UTSW 10 86354477 missense probably benign 0.35
Z1177:Syn3 UTSW 10 86080209 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGATGAACGCCTCCTGCTC -3'
(R):5'- TCTGACAGCAGCTTTGTGGC -3'

Sequencing Primer
(F):5'- GCTAGCCTCAGAAACTATGTAAGC -3'
(R):5'- AGCTTTGTGGCCAACCTG -3'
Posted On2016-04-15