Incidental Mutation 'R4904:Xpot'
List |< first << previous [record 67 of 69] next >> last >|
ID378046
Institutional Source Beutler Lab
Gene Symbol Xpot
Ensembl Gene ENSMUSG00000034667
Gene Nameexportin, tRNA (nuclear export receptor for tRNAs)
Synonyms1110004L07Rik, C79645, EXPORTIN-T
MMRRC Submission 042507-MU
Accession Numbers

Genbank: NM_001081056; MGI: 1920442

Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121587380-121626332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121617178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 52 (V52I)
Ref Sequence ENSEMBL: ENSMUSP00000151722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039810] [ENSMUST00000217865] [ENSMUST00000218004]
Predicted Effect probably benign
Transcript: ENSMUST00000039810
AA Change: V52I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043488
Gene: ENSMUSG00000034667
AA Change: V52I

DomainStartEndE-ValueType
IBN_N 21 89 1.37e-3 SMART
Pfam:Xpo1 98 248 5.1e-42 PFAM
low complexity region 386 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175100
Predicted Effect probably benign
Transcript: ENSMUST00000217865
Predicted Effect probably benign
Transcript: ENSMUST00000218004
AA Change: V52I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAN-GTPase exportin family that mediates export of tRNA from the nucleus to the cytoplasm. Translocation of tRNA to the cytoplasm occurs once exportin has bound both tRNA and GTP-bound RAN. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Xpot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Xpot APN 10 121605644 missense probably benign
IGL01286:Xpot APN 10 121602338 missense probably benign 0.03
IGL01364:Xpot APN 10 121604494 missense probably benign 0.08
IGL01370:Xpot APN 10 121604494 missense probably benign 0.08
IGL01516:Xpot APN 10 121590222 splice site probably null
IGL01530:Xpot APN 10 121611528 missense probably damaging 0.99
IGL02047:Xpot APN 10 121601362 unclassified probably benign
IGL02207:Xpot APN 10 121613580 missense probably damaging 1.00
IGL02340:Xpot APN 10 121615204 missense probably damaging 1.00
IGL02408:Xpot APN 10 121603165 missense probably damaging 1.00
IGL03150:Xpot APN 10 121609186 missense probably benign 0.00
IGL03210:Xpot APN 10 121615227 splice site probably benign
3-1:Xpot UTSW 10 121613359 missense probably benign 0.00
R0077:Xpot UTSW 10 121605639 missense probably benign 0.09
R1750:Xpot UTSW 10 121603027 critical splice donor site probably null
R1806:Xpot UTSW 10 121607638 splice site probably benign
R1950:Xpot UTSW 10 121619148 missense probably benign
R2227:Xpot UTSW 10 121622860 missense probably damaging 0.98
R2304:Xpot UTSW 10 121611583 missense probably benign 0.02
R3914:Xpot UTSW 10 121604538 missense possibly damaging 0.72
R4784:Xpot UTSW 10 121615063 splice site probably null
R4884:Xpot UTSW 10 121606808 missense probably damaging 1.00
R5218:Xpot UTSW 10 121619138 missense probably damaging 0.99
R5361:Xpot UTSW 10 121600860 missense possibly damaging 0.71
R5651:Xpot UTSW 10 121604549 missense probably damaging 0.99
R5894:Xpot UTSW 10 121613646 missense probably damaging 1.00
R5915:Xpot UTSW 10 121615093 missense probably damaging 0.97
R6139:Xpot UTSW 10 121611708 missense probably benign 0.41
R6182:Xpot UTSW 10 121606258 missense probably damaging 1.00
R6896:Xpot UTSW 10 121613485 critical splice donor site probably null
R7024:Xpot UTSW 10 121602399 missense probably benign 0.35
R7146:Xpot UTSW 10 121606773 missense probably damaging 1.00
R7272:Xpot UTSW 10 121617189 critical splice acceptor site probably null
R7556:Xpot UTSW 10 121613506 missense probably benign 0.01
R7882:Xpot UTSW 10 121619091 critical splice donor site probably null
R7916:Xpot UTSW 10 121622943 start gained probably benign
R8087:Xpot UTSW 10 121601327 missense probably benign
R8224:Xpot UTSW 10 121607608 missense probably damaging 1.00
R8303:Xpot UTSW 10 121611500 nonsense probably null
Z1088:Xpot UTSW 10 121601323 missense probably damaging 0.99
Z1176:Xpot UTSW 10 121617174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTTCAGTTCTCCATCAGAC -3'
(R):5'- TGCCCTCGAAGAATAAAGCAG -3'

Sequencing Primer
(F):5'- GGTTCAGTTCTCCATCAGACAAAATG -3'
(R):5'- AGGCCTGTAGTGGCTATT -3'
Posted On2016-04-15