Incidental Mutation 'R4904:Ebf1'
ID 378047
Institutional Source Beutler Lab
Gene Symbol Ebf1
Ensembl Gene ENSMUSG00000057098
Gene Name early B cell factor 1
Synonyms Olf1, O/E-1, Olf-1
MMRRC Submission 042507-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.896) question?
Stock # R4904 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 44508144-44898918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44759996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 211 (F211S)
Ref Sequence ENSEMBL: ENSMUSP00000104891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081265] [ENSMUST00000101326] [ENSMUST00000109268]
AlphaFold Q07802
Predicted Effect probably damaging
Transcript: ENSMUST00000081265
AA Change: F211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098
AA Change: F211S

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101326
AA Change: F211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098
AA Change: F211S

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109268
AA Change: F211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098
AA Change: F211S

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 129,906,332 (GRCm39) I920S possibly damaging Het
Afap1l1 A G 18: 61,871,786 (GRCm39) I556T probably benign Het
Ankfy1 C A 11: 72,642,931 (GRCm39) H665N probably benign Het
Aqp9 A C 9: 71,069,685 (GRCm39) probably benign Het
Arhgap21 A G 2: 20,854,872 (GRCm39) S1497P probably benign Het
Armc7 A G 11: 115,379,800 (GRCm39) D166G probably damaging Het
Arrdc1 C A 2: 24,816,676 (GRCm39) V167F possibly damaging Het
Col6a3 A T 1: 90,729,164 (GRCm39) I1259N probably damaging Het
Coq8a C T 1: 180,006,168 (GRCm39) R207Q probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dcbld1 C T 10: 52,196,066 (GRCm39) Q425* probably null Het
Def8 A G 8: 124,188,219 (GRCm39) N445D probably damaging Het
Dicer1 C T 12: 104,679,325 (GRCm39) V551I probably benign Het
Dst A T 1: 34,208,879 (GRCm39) T800S probably damaging Het
Dtl A T 1: 191,300,457 (GRCm39) C136S probably damaging Het
Duox1 T A 2: 122,151,345 (GRCm39) Y310N probably damaging Het
Duxf1 T A 10: 58,059,309 (GRCm39) R482* probably null Het
Gm44501 A T 17: 40,889,884 (GRCm39) I133F possibly damaging Het
Gm6625 T C 8: 89,873,379 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,713,748 (GRCm39) D243V probably damaging Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Gtf2a1l G A 17: 88,997,471 (GRCm39) probably null Het
Herc2 T C 7: 55,807,234 (GRCm39) F2471L probably damaging Het
Hfe A T 13: 23,892,037 (GRCm39) I109N probably damaging Het
Hrg A G 16: 22,770,000 (GRCm39) E43G probably benign Het
Hspa1a T C 17: 35,189,427 (GRCm39) D492G probably damaging Het
Itgb8 T C 12: 119,134,606 (GRCm39) D487G probably benign Het
Jag1 A G 2: 136,929,062 (GRCm39) V798A probably damaging Het
Kcnq5 A G 1: 21,494,324 (GRCm39) V501A probably damaging Het
Kntc1 T C 5: 123,916,396 (GRCm39) V743A possibly damaging Het
Ly86 G T 13: 37,599,496 (GRCm39) V126F possibly damaging Het
Med26 A T 8: 73,250,691 (GRCm39) L136H probably damaging Het
Mpp3 T C 11: 101,891,413 (GRCm39) D575G probably benign Het
Myoc G A 1: 162,466,994 (GRCm39) M54I probably benign Het
Nlrp1c-ps A G 11: 71,133,454 (GRCm39) noncoding transcript Het
Or10v9 C T 19: 11,833,231 (GRCm39) V29M possibly damaging Het
Or51t4 A G 7: 102,598,272 (GRCm39) Y190C probably damaging Het
Or5v1b A G 17: 37,841,522 (GRCm39) Y218C probably damaging Het
Pak5 A T 2: 135,925,267 (GRCm39) D678E probably benign Het
Pcdhb12 T C 18: 37,570,909 (GRCm39) V685A possibly damaging Het
Pcdhga2 A G 18: 37,802,932 (GRCm39) T259A possibly damaging Het
Pde6a A T 18: 61,398,105 (GRCm39) M702L probably benign Het
Pigq A G 17: 26,150,034 (GRCm39) probably benign Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Ptch1 A C 13: 63,670,818 (GRCm39) I904S probably damaging Het
Rflnb A T 11: 75,912,964 (GRCm39) C141* probably null Het
Rilpl1 C A 5: 124,652,807 (GRCm39) probably null Het
Rpgrip1 T C 14: 52,358,544 (GRCm39) S217P possibly damaging Het
Rpgrip1 A T 14: 52,397,586 (GRCm39) I1292F probably damaging Het
Sema3a A C 5: 13,631,066 (GRCm39) Y534S probably damaging Het
Sez6 A G 11: 77,866,080 (GRCm39) Y736C probably damaging Het
Shank1 G T 7: 43,983,464 (GRCm39) probably benign Het
Slc45a4 G A 15: 73,458,691 (GRCm39) S294F probably benign Het
Slc9a8 A G 2: 167,313,316 (GRCm39) I393V possibly damaging Het
Sod1 T A 16: 90,019,732 (GRCm39) F46Y probably damaging Het
Sult1b1 T C 5: 87,682,912 (GRCm39) D11G probably benign Het
Syn3 T G 10: 86,302,950 (GRCm39) K68N possibly damaging Het
Taar8c C T 10: 23,977,147 (GRCm39) V222I probably benign Het
Tbx20 T C 9: 24,670,129 (GRCm39) K235E probably damaging Het
Tcaf3 C A 6: 42,570,931 (GRCm39) E274* probably null Het
Tll1 A T 8: 64,523,233 (GRCm39) M493K probably benign Het
Tmem236 T A 2: 14,200,803 (GRCm39) S123T probably benign Het
Trim33 T C 3: 103,238,963 (GRCm39) V647A possibly damaging Het
Tspear T A 10: 77,705,489 (GRCm39) Y296N possibly damaging Het
Vps13d T C 4: 144,882,015 (GRCm39) K1187E probably damaging Het
Xpot C T 10: 121,453,083 (GRCm39) V52I probably benign Het
Zdhhc3 A T 9: 122,929,452 (GRCm39) V61E probably damaging Het
Zfp955a A T 17: 33,461,162 (GRCm39) C323* probably null Het
Other mutations in Ebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44,759,927 (GRCm39) missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44,863,739 (GRCm39) missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44,815,403 (GRCm39) critical splice donor site probably null
Befuddled UTSW 11 44,523,602 (GRCm39) missense probably damaging 0.98
Catastrophic UTSW 11 44,774,712 (GRCm39) missense probably damaging 1.00
Crabapple UTSW 11 44,774,666 (GRCm39) missense probably damaging 1.00
Crater_lake UTSW 11 44,863,735 (GRCm39) nonsense probably null
ebby UTSW 11 44,774,641 (GRCm39) missense probably damaging 1.00
Oregano UTSW 11 44,759,996 (GRCm39) missense probably damaging 1.00
Oregano2 UTSW 11 44,881,331 (GRCm39) splice site probably null
Realtor UTSW 11 44,511,374 (GRCm39) missense probably benign 0.05
Vie UTSW 11 44,863,742 (GRCm39) missense probably damaging 1.00
R0102:Ebf1 UTSW 11 44,882,282 (GRCm39) missense probably benign 0.02
R0102:Ebf1 UTSW 11 44,882,282 (GRCm39) missense probably benign 0.02
R0141:Ebf1 UTSW 11 44,798,827 (GRCm39) missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44,886,949 (GRCm39) missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44,759,915 (GRCm39) splice site probably benign
R0268:Ebf1 UTSW 11 44,534,240 (GRCm39) missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44,815,297 (GRCm39) nonsense probably null
R0648:Ebf1 UTSW 11 44,882,337 (GRCm39) missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44,759,987 (GRCm39) missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44,523,602 (GRCm39) missense probably damaging 0.98
R1432:Ebf1 UTSW 11 44,895,533 (GRCm39) splice site probably benign
R1713:Ebf1 UTSW 11 44,815,393 (GRCm39) missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44,798,835 (GRCm39) missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44,512,793 (GRCm39) missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44,882,349 (GRCm39) missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44,534,225 (GRCm39) splice site probably benign
R4538:Ebf1 UTSW 11 44,798,822 (GRCm39) missense probably benign 0.07
R4666:Ebf1 UTSW 11 44,882,384 (GRCm39) missense probably damaging 0.99
R4855:Ebf1 UTSW 11 44,863,735 (GRCm39) nonsense probably null
R5137:Ebf1 UTSW 11 44,882,295 (GRCm39) missense probably damaging 1.00
R5569:Ebf1 UTSW 11 44,883,228 (GRCm39) missense possibly damaging 0.82
R5849:Ebf1 UTSW 11 44,881,331 (GRCm39) splice site probably null
R5940:Ebf1 UTSW 11 44,512,048 (GRCm39) missense probably damaging 1.00
R5989:Ebf1 UTSW 11 44,886,998 (GRCm39) missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44,774,712 (GRCm39) missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44,883,168 (GRCm39) missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44,774,641 (GRCm39) missense probably damaging 1.00
R7031:Ebf1 UTSW 11 44,512,795 (GRCm39) missense possibly damaging 0.95
R7042:Ebf1 UTSW 11 44,882,338 (GRCm39) missense probably damaging 0.99
R8065:Ebf1 UTSW 11 44,511,374 (GRCm39) missense probably benign 0.05
R8067:Ebf1 UTSW 11 44,511,374 (GRCm39) missense probably benign 0.05
R8125:Ebf1 UTSW 11 44,863,742 (GRCm39) missense probably damaging 1.00
R8413:Ebf1 UTSW 11 44,534,274 (GRCm39) missense possibly damaging 0.92
R8863:Ebf1 UTSW 11 44,774,666 (GRCm39) missense probably damaging 1.00
R9178:Ebf1 UTSW 11 44,895,548 (GRCm39) missense probably benign 0.20
R9178:Ebf1 UTSW 11 44,883,276 (GRCm39) missense probably benign 0.04
R9511:Ebf1 UTSW 11 44,815,393 (GRCm39) missense probably benign 0.03
R9603:Ebf1 UTSW 11 44,509,006 (GRCm39) start codon destroyed probably null 0.07
Predicted Primers PCR Primer
(F):5'- TCCCTGGGATGCAATATCAAGC -3'
(R):5'- AGATTGCAGAGATGCCTGGG -3'

Sequencing Primer
(F):5'- CCACCCTGAGTTTTGCAGGAAAG -3'
(R):5'- GGACCAGTAGCCTCACCTG -3'
Posted On 2016-04-15