Incidental Mutation 'R4904:Ebf1'
ID378047
Institutional Source Beutler Lab
Gene Symbol Ebf1
Ensembl Gene ENSMUSG00000057098
Gene Nameearly B cell factor 1
SynonymsOlf1, O/E-1, Olf-1
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location44617317-45008091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44869169 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 211 (F211S)
Ref Sequence ENSEMBL: ENSMUSP00000104891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081265] [ENSMUST00000101326] [ENSMUST00000109268]
Predicted Effect probably damaging
Transcript: ENSMUST00000081265
AA Change: F211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098
AA Change: F211S

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101326
AA Change: F211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098
AA Change: F211S

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109268
AA Change: F211S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098
AA Change: F211S

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Ebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44869100 missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44972912 missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44924576 critical splice donor site probably null
Befuddled UTSW 11 44632775 missense probably damaging 0.98
Catastrophic UTSW 11 44883885 missense probably damaging 1.00
Crater_lake UTSW 11 44972908 nonsense probably null
ebby UTSW 11 44883814 missense probably damaging 1.00
oregano UTSW 11 44869169 missense probably damaging 1.00
Oregano2 UTSW 11 44990504 splice site probably null
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0102:Ebf1 UTSW 11 44991455 missense probably benign 0.02
R0141:Ebf1 UTSW 11 44908000 missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44996122 missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44869088 splice site probably benign
R0268:Ebf1 UTSW 11 44643413 missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44924470 nonsense probably null
R0648:Ebf1 UTSW 11 44991510 missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44869160 missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44632775 missense probably damaging 0.98
R1432:Ebf1 UTSW 11 45004706 splice site probably benign
R1713:Ebf1 UTSW 11 44924566 missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44908008 missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44621966 missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44991522 missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44643398 splice site probably benign
R4538:Ebf1 UTSW 11 44907995 missense probably benign 0.07
R4666:Ebf1 UTSW 11 44991557 missense probably damaging 0.99
R4855:Ebf1 UTSW 11 44972908 nonsense probably null
R5137:Ebf1 UTSW 11 44991468 missense probably damaging 1.00
R5569:Ebf1 UTSW 11 44992401 missense possibly damaging 0.82
R5849:Ebf1 UTSW 11 44990504 splice site probably null
R5940:Ebf1 UTSW 11 44621221 missense probably damaging 1.00
R5989:Ebf1 UTSW 11 44996171 missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44883885 missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44992341 missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44883814 missense probably damaging 1.00
R7031:Ebf1 UTSW 11 44621968 missense possibly damaging 0.95
R7042:Ebf1 UTSW 11 44991511 missense probably damaging 0.99
R8065:Ebf1 UTSW 11 44620547 missense probably benign 0.05
R8067:Ebf1 UTSW 11 44620547 missense probably benign 0.05
R8125:Ebf1 UTSW 11 44972915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGGGATGCAATATCAAGC -3'
(R):5'- AGATTGCAGAGATGCCTGGG -3'

Sequencing Primer
(F):5'- CCACCCTGAGTTTTGCAGGAAAG -3'
(R):5'- GGACCAGTAGCCTCACCTG -3'
Posted On2016-04-15