Incidental Mutation 'R4904:Hfe'
ID378057
Institutional Source Beutler Lab
Gene Symbol Hfe
Ensembl Gene ENSMUSG00000006611
Gene Namehemochromatosis
SynonymsMR2
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23702034-23710854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23708054 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 109 (I109N)
Ref Sequence ENSEMBL: ENSMUSP00000089298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006787] [ENSMUST00000091706] [ENSMUST00000091707]
Predicted Effect probably benign
Transcript: ENSMUST00000006787
SMART Domains Protein: ENSMUSP00000006787
Gene: ENSMUSG00000006611

DomainStartEndE-ValueType
IGc1 44 116 1.03e-14 SMART
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091706
AA Change: I109N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089298
Gene: ENSMUSG00000006611
AA Change: I109N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 30 214 4e-46 PFAM
Pfam:MHC_I_3 53 212 7.4e-12 PFAM
IGc1 232 304 1.03e-14 SMART
transmembrane domain 318 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091707
SMART Domains Protein: ENSMUSP00000089299
Gene: ENSMUSG00000006611

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 34 126 7.3e-24 PFAM
IGc1 144 216 1.03e-14 SMART
transmembrane domain 230 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151243
Meta Mutation Damage Score 0.7978 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene affects iron metabolism. Homozygotes for targeted null mutations exhibit increased intestinal iron absorption and an elevated hepatic iron load but reduced duodenal iron stores. Heterozygotes also accumulate more iron than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Hfe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Hfe APN 13 23705852 unclassified probably benign
IGL01733:Hfe APN 13 23706865 missense possibly damaging 0.51
IGL02227:Hfe APN 13 23706943 missense probably benign 0.26
IGL02339:Hfe APN 13 23704390 missense probably damaging 0.98
R1669:Hfe UTSW 13 23706127 nonsense probably null
R1704:Hfe UTSW 13 23704408 missense probably damaging 1.00
R4424:Hfe UTSW 13 23706883 missense probably benign 0.06
R4624:Hfe UTSW 13 23706078 nonsense probably null
R5926:Hfe UTSW 13 23708264 missense probably damaging 0.99
R6246:Hfe UTSW 13 23708229 missense probably damaging 1.00
R6322:Hfe UTSW 13 23705896 missense probably damaging 1.00
R6636:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6636:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R6637:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6637:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R7167:Hfe UTSW 13 23708069 missense probably damaging 1.00
R7374:Hfe UTSW 13 23706047 missense probably damaging 0.99
R7816:Hfe UTSW 13 23704399 missense possibly damaging 0.53
Z1177:Hfe UTSW 13 23706037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTAGGCCTAGGTTAGCAGAC -3'
(R):5'- AGATACCTCTTCATGGGTGCC -3'

Sequencing Primer
(F):5'- CCTAGGTTAGCAGACAGAGGC -3'
(R):5'- CTCTTCATGGGTGCCTCAGAG -3'
Posted On2016-04-15