Incidental Mutation 'R4904:Slc45a4'
ID378062
Institutional Source Beutler Lab
Gene Symbol Slc45a4
Ensembl Gene ENSMUSG00000079020
Gene Namesolute carrier family 45, member 4
Synonyms9330175B01Rik
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4904 (G1)
Quality Score100
Status Validated
Chromosome15
Chromosomal Location73577424-73645762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73586842 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 294 (S294F)
Ref Sequence ENSEMBL: ENSMUSP00000054651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054266] [ENSMUST00000076224] [ENSMUST00000132607] [ENSMUST00000151288]
Predicted Effect probably benign
Transcript: ENSMUST00000054266
AA Change: S294F

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054651
Gene: ENSMUSG00000079020
AA Change: S294F

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 501 518 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
transmembrane domain 585 604 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 685 707 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
low complexity region 754 770 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076224
AA Change: S286F

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075577
Gene: ENSMUSG00000079020
AA Change: S286F

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132607
AA Change: S92F

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115827
Gene: ENSMUSG00000079020
AA Change: S92F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
low complexity region 286 297 N/A INTRINSIC
low complexity region 299 316 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
transmembrane domain 383 402 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144936
AA Change: S221F
SMART Domains Protein: ENSMUSP00000122825
Gene: ENSMUSG00000079020
AA Change: S221F

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
transmembrane domain 461 483 N/A INTRINSIC
transmembrane domain 513 532 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
transmembrane domain 571 593 N/A INTRINSIC
transmembrane domain 613 635 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 682 698 N/A INTRINSIC
low complexity region 703 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151288
AA Change: S286F

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121775
Gene: ENSMUSG00000079020
AA Change: S286F

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152558
SMART Domains Protein: ENSMUSP00000114790
Gene: ENSMUSG00000079020

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 112 131 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Slc45a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Slc45a4 APN 15 73587655 missense probably damaging 1.00
IGL02506:Slc45a4 APN 15 73581838 missense probably benign 0.00
IGL02642:Slc45a4 APN 15 73586815 missense probably benign
IGL03195:Slc45a4 APN 15 73584423 missense possibly damaging 0.89
Undefined UTSW 15 73584450 missense probably damaging 1.00
R0048:Slc45a4 UTSW 15 73605436 splice site probably benign
R0189:Slc45a4 UTSW 15 73581914 missense probably benign 0.00
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0828:Slc45a4 UTSW 15 73586816 missense probably benign 0.01
R1172:Slc45a4 UTSW 15 73605429 splice site probably benign
R1331:Slc45a4 UTSW 15 73586747 missense probably benign 0.00
R1739:Slc45a4 UTSW 15 73586038 missense probably damaging 1.00
R2310:Slc45a4 UTSW 15 73589560 missense probably damaging 1.00
R4695:Slc45a4 UTSW 15 73582075 missense possibly damaging 0.94
R4974:Slc45a4 UTSW 15 73584450 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6114:Slc45a4 UTSW 15 73605604 missense probably damaging 0.96
R7057:Slc45a4 UTSW 15 73587638 missense probably damaging 1.00
R7221:Slc45a4 UTSW 15 73586410 missense probably benign 0.06
R7288:Slc45a4 UTSW 15 73586936 nonsense probably null
R7331:Slc45a4 UTSW 15 73605640 missense probably benign 0.02
R7901:Slc45a4 UTSW 15 73605772 start gained probably benign
R7957:Slc45a4 UTSW 15 73584335 splice site probably null
R7984:Slc45a4 UTSW 15 73605772 start gained probably benign
R8003:Slc45a4 UTSW 15 73585313 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATGCAGGAAGAGCAGCTG -3'
(R):5'- TATCTACAGGCCTTGGTGGG -3'

Sequencing Primer
(F):5'- TGGGGCTCCATGTCCAGTG -3'
(R):5'- TCCTAGGTGACTGGTTCCAGAC -3'
Posted On2016-04-15