Incidental Mutation 'R4904:Sod1'
ID378066
Institutional Source Beutler Lab
Gene Symbol Sod1
Ensembl Gene ENSMUSG00000022982
Gene Namesuperoxide dismutase 1, soluble
SynonymsCu/Zn-SOD, CuZnSOD, SODC, Ipo1, Cu(2+)-Zn2+ superoxide dismutase, Ipo-1, Sod-1, B430204E11Rik
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90220754-90226329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90222844 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 46 (F46Y)
Ref Sequence ENSEMBL: ENSMUSP00000023707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023707]
PDB Structure
Mouse SOD1 [X-RAY DIFFRACTION]
Human-mouse SOD1 chimera [X-RAY DIFFRACTION]
Mouse-human sod1 chimera [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023707
AA Change: F46Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023707
Gene: ENSMUSG00000022982
AA Change: F46Y

DomainStartEndE-ValueType
Pfam:Sod_Cu 9 150 2.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232505
Meta Mutation Damage Score 0.9326 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit increased motor neuron loss after axonal injury and enhanced susceptibility to ischemic reperfusion injury. Homozygous females have irregular and small litters, and for some alleles exhibit immature ovarian follicles with few corpora lutea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Sod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Sod1 APN 16 90225238 missense probably benign 0.01
R0930:Sod1 UTSW 16 90225183 missense probably benign
R2168:Sod1 UTSW 16 90220913 missense possibly damaging 0.85
R7538:Sod1 UTSW 16 90226226 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTCTACTTGGATCTGAACATAG -3'
(R):5'- GGCTACTTTCCAAGGTTGACC -3'

Sequencing Primer
(F):5'- CTACTTGGATCTGAACATAGGTTTG -3'
(R):5'- AATTGGGTCCTGACTCAG -3'
Posted On2016-04-15