Incidental Mutation 'R4904:Pigq'
ID378067
Institutional Source Beutler Lab
Gene Symbol Pigq
Ensembl Gene ENSMUSG00000025728
Gene Namephosphatidylinositol glycan anchor biosynthesis, class Q
SynonymsGpi1h, Gpi1, Gpi1p, Gpih
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4904 (G1)
Quality Score199
Status Validated
Chromosome17
Chromosomal Location25926421-25944510 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 25931060 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026823] [ENSMUST00000097368] [ENSMUST00000135253] [ENSMUST00000139226] [ENSMUST00000140304] [ENSMUST00000207073] [ENSMUST00000208043] [ENSMUST00000208071] [ENSMUST00000208242] [ENSMUST00000208499]
Predicted Effect probably benign
Transcript: ENSMUST00000026823
SMART Domains Protein: ENSMUSP00000026823
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Pfam:Gpi1 274 463 5.1e-79 PFAM
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097368
SMART Domains Protein: ENSMUSP00000094981
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Pfam:Gpi1 365 523 8.6e-66 PFAM
transmembrane domain 538 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123929
Predicted Effect probably benign
Transcript: ENSMUST00000133650
SMART Domains Protein: ENSMUSP00000117102
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 118 132 N/A INTRINSIC
Pfam:Gpi1 180 367 2.4e-71 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135253
SMART Domains Protein: ENSMUSP00000122239
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 59 78 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139078
Predicted Effect probably benign
Transcript: ENSMUST00000139226
SMART Domains Protein: ENSMUSP00000115447
Gene: ENSMUSG00000025728

DomainStartEndE-ValueType
low complexity region 214 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect probably benign
Transcript: ENSMUST00000207073
Predicted Effect probably benign
Transcript: ENSMUST00000207496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207777
Predicted Effect probably benign
Transcript: ENSMUST00000208043
Predicted Effect probably benign
Transcript: ENSMUST00000208071
Predicted Effect probably benign
Transcript: ENSMUST00000208242
Predicted Effect probably benign
Transcript: ENSMUST00000208499
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is involved in the first step in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a N-acetylglucosaminyl transferase component that is part of the complex that catalyzes transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Pigq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Pigq APN 17 25927686 missense possibly damaging 0.86
IGL02516:Pigq APN 17 25937247 missense probably benign 0.01
R0669:Pigq UTSW 17 25936762 critical splice donor site probably null
R1830:Pigq UTSW 17 25935006 missense probably benign 0.31
R2232:Pigq UTSW 17 25932209 missense probably benign 0.00
R5008:Pigq UTSW 17 25934203 missense probably benign
R5394:Pigq UTSW 17 25931472 missense possibly damaging 0.88
R5764:Pigq UTSW 17 25932119 missense probably damaging 0.99
R6814:Pigq UTSW 17 25931656 unclassified probably benign
R6880:Pigq UTSW 17 25934828 missense probably damaging 1.00
R7198:Pigq UTSW 17 25934225 missense probably benign 0.01
R7456:Pigq UTSW 17 25934606 missense unknown
R7806:Pigq UTSW 17 25931726 missense probably benign 0.45
R7895:Pigq UTSW 17 25937325 missense probably benign 0.34
R7978:Pigq UTSW 17 25937325 missense probably benign 0.34
X0020:Pigq UTSW 17 25931523 missense probably damaging 0.96
X0067:Pigq UTSW 17 25935006 missense probably benign 0.31
Z1177:Pigq UTSW 17 25926488 missense
Z1177:Pigq UTSW 17 25926495 missense
Predicted Primers PCR Primer
(F):5'- AGATAGCCTGTTTCCTGTGTGC -3'
(R):5'- TCCATTTGCTTACCCAGATGTG -3'

Sequencing Primer
(F):5'- TCCTGTGTGCCTGGCTCAG -3'
(R):5'- CCCAGATGTGATACATGAAGTTTCCC -3'
Posted On2016-04-15