Incidental Mutation 'R4904:Olfr1418'
ID378077
Institutional Source Beutler Lab
Gene Symbol Olfr1418
Ensembl Gene ENSMUSG00000060556
Gene Nameolfactory receptor 1418
SynonymsMOR266-5, GA_x6K02T2RE5P-2207258-2206302
MMRRC Submission 042507-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4904 (G1)
Quality Score146
Status Validated
Chromosome19
Chromosomal Location11852587-11861066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11855867 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 29 (V29M)
Ref Sequence ENSEMBL: ENSMUSP00000150146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079875] [ENSMUST00000214796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079875
AA Change: V29M

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078800
Gene: ENSMUSG00000060556
AA Change: V29M

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 4.2e-53 PFAM
Pfam:7tm_1 41 291 5.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214796
AA Change: V29M

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.3456 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Duox1 T A 2: 122,320,864 Y310N probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Olfr1418
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0638:Olfr1418 UTSW 19 11855123 missense probably damaging 1.00
R0638:Olfr1418 UTSW 19 11855368 missense probably damaging 0.97
R1882:Olfr1418 UTSW 19 11855471 missense probably damaging 1.00
R1981:Olfr1418 UTSW 19 11855007 missense possibly damaging 0.65
R3896:Olfr1418 UTSW 19 11855587 missense probably damaging 1.00
R4853:Olfr1418 UTSW 19 11855281 missense probably benign
R5385:Olfr1418 UTSW 19 11855177 missense probably damaging 1.00
R6197:Olfr1418 UTSW 19 11855784 missense probably damaging 0.99
R7138:Olfr1418 UTSW 19 11855288 missense probably damaging 1.00
R8114:Olfr1418 UTSW 19 11855102 missense probably damaging 1.00
Z1177:Olfr1418 UTSW 19 11855172 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTCTCTGTGGACAGGATG -3'
(R):5'- GAGGAACTGCTATGTCAAGAGC -3'

Sequencing Primer
(F):5'- ACAGGATGCTGGCCAGAGTC -3'
(R):5'- CTGCTATGTCAAGAGCCTATGAC -3'
Posted On2016-04-15