Incidental Mutation 'R0304:Sart1'
ID37808
Institutional Source Beutler Lab
Gene Symbol Sart1
Ensembl Gene ENSMUSG00000039148
Gene Namesquamous cell carcinoma antigen recognized by T cells 1
SynonymsU5-110K
MMRRC Submission 038515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0304 (G1)
Quality Score136
Status Validated
Chromosome19
Chromosomal Location5377523-5388703 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 5380531 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044207]
Predicted Effect probably benign
Transcript: ENSMUST00000044207
SMART Domains Protein: ENSMUSP00000047397
Gene: ENSMUSG00000039148

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 31 83 N/A INTRINSIC
Pfam:SART-1 117 759 1.5e-151 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins, the SART1(800) protein expressed in the nucleus of the majority of proliferating cells, and the SART1(259) protein expressed in the cytosol of epithelial cancers. The SART1(259) protein is translated by the mechanism of -1 frameshifting during posttranscriptional regulation; its full-length sequence is not published yet. The two encoded proteins are thought to be involved in the regulation of proliferation. Both proteins have tumor-rejection antigens. The SART1(259) protein possesses tumor epitopes capable of inducing HLA-A2402-restricted cytotoxic T lymphocytes in cancer patients. This SART1(259) antigen may be useful in specific immunotherapy for cancer patients and may serve as a paradigmatic tool for the diagnosis and treatment of patients with atopy. The SART1(259) protein is found to be essential for the recruitment of the tri-snRNP to the pre-spliceosome in the spliceosome assembly pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik C T 4: 144,520,049 T55I probably benign Het
Acod1 T A 14: 103,054,982 I314N probably damaging Het
Actl11 T A 9: 107,929,768 V430E probably damaging Het
Adam19 A C 11: 46,127,392 D427A possibly damaging Het
Adarb2 C T 13: 8,752,570 probably benign Het
Akap7 A T 10: 25,271,552 H93Q probably damaging Het
Ankrd36 C A 11: 5,628,981 R82S possibly damaging Het
Arhgap21 A T 2: 20,859,801 probably benign Het
Atm T A 9: 53,516,344 I489F probably benign Het
AU019823 T C 9: 50,607,922 D130G probably damaging Het
Carmil1 T C 13: 24,139,341 S243G probably damaging Het
Cdc42bpg T C 19: 6,317,248 V939A probably damaging Het
Cel A C 2: 28,557,771 L377R probably benign Het
Clock A G 5: 76,226,985 V779A unknown Het
Cluap1 G A 16: 3,929,918 probably benign Het
Ctif A T 18: 75,521,818 H212Q probably benign Het
Cyp4a29 T A 4: 115,252,932 probably benign Het
Cytip T C 2: 58,148,246 N101S possibly damaging Het
D130043K22Rik T C 13: 24,864,815 M434T probably benign Het
Ddx47 A G 6: 135,017,220 I154V possibly damaging Het
Dnah6 C T 6: 73,159,115 E1014K probably damaging Het
Dnajc27 T G 12: 4,106,793 probably benign Het
Drc7 A T 8: 95,059,128 D204V probably damaging Het
Dsc3 A G 18: 19,981,241 Y319H probably damaging Het
Eml6 T C 11: 29,777,441 Q1227R probably benign Het
Enpp2 A T 15: 54,877,806 D365E probably benign Het
Ercc2 T C 7: 19,386,708 I199T possibly damaging Het
Exd2 G A 12: 80,491,240 probably benign Het
F2 A T 2: 91,633,233 I128N probably damaging Het
Fam219b T C 9: 57,538,876 L123P probably damaging Het
Fasn A G 11: 120,819,936 V299A possibly damaging Het
Fastkd2 T C 1: 63,752,400 V689A possibly damaging Het
Fbxw13 C T 9: 109,194,721 R85Q probably benign Het
Fer1l6 A G 15: 58,590,562 Y822C probably benign Het
Fhl5 T C 4: 25,207,241 T176A probably benign Het
Gm20530 T G 17: 36,094,226 noncoding transcript Het
Gm4787 A T 12: 81,378,934 I150N probably damaging Het
Grip1 G A 10: 120,075,471 S618N probably benign Het
Hdac9 T C 12: 34,374,111 K454E probably damaging Het
Iars2 T A 1: 185,287,156 I978F possibly damaging Het
Icosl A G 10: 78,075,322 Y299C probably benign Het
Idi1 T C 13: 8,890,357 Y192H probably damaging Het
Iqub T G 6: 24,454,291 Q531P probably damaging Het
Itih4 T A 14: 30,890,094 probably null Het
Izumo4 A T 10: 80,702,936 H71L probably damaging Het
Jcad A T 18: 4,673,325 E362D possibly damaging Het
Kif21a G T 15: 90,976,521 probably null Het
Kynu A T 2: 43,679,881 I392F probably damaging Het
Luc7l2 A G 6: 38,592,776 E223G probably damaging Het
Map3k8 A C 18: 4,339,552 L273R probably damaging Het
Max A G 12: 76,938,587 L119P probably benign Het
Mphosph9 T C 5: 124,298,829 N484S probably benign Het
Mrgprg A G 7: 143,765,055 Y107H probably damaging Het
Mrps31 A T 8: 22,421,338 I199F probably benign Het
Mtr C G 13: 12,222,154 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nptx2 A G 5: 144,553,650 probably benign Het
Nrip1 T C 16: 76,292,707 Q654R possibly damaging Het
Ocm A G 5: 144,024,534 F30L probably damaging Het
Olfr1216 G A 2: 89,013,288 R259W probably damaging Het
Olfr1223 A C 2: 89,144,764 Y86* probably null Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Olfr600 G T 7: 103,346,711 D72E probably damaging Het
Oosp1 T C 19: 11,690,969 M17V probably benign Het
Pax1 A T 2: 147,366,147 Y225F probably benign Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pkd1 C A 17: 24,585,946 Q3190K probably damaging Het
Pkn1 A C 8: 83,683,607 probably benign Het
Plin5 T C 17: 56,115,597 D113G probably damaging Het
Ppfia1 A G 7: 144,482,345 V1141A probably damaging Het
Ppp4r1 T A 17: 65,816,006 D334E probably benign Het
Ptov1 A T 7: 44,863,449 probably null Het
Rab22a G A 2: 173,661,459 V22M probably damaging Het
Rictor T A 15: 6,786,371 probably null Het
Scn11a G A 9: 119,819,862 A45V probably benign Het
Serpina5 A G 12: 104,103,200 T224A possibly damaging Het
Siglecf G T 7: 43,352,401 G212C probably damaging Het
Slc38a4 A T 15: 97,008,454 M378K probably damaging Het
Spata22 T A 11: 73,340,449 C176* probably null Het
Tmc3 G A 7: 83,596,139 E131K probably damaging Het
Trappc10 A T 10: 78,210,760 probably benign Het
Uvrag A G 7: 98,887,973 F672L probably benign Het
Vmn1r121 A G 7: 21,098,407 V36A possibly damaging Het
Vmn1r13 A T 6: 57,210,626 M257L probably benign Het
Vmn1r58 C T 7: 5,410,496 C245Y probably damaging Het
Vmn1r86 C A 7: 13,102,780 M56I probably benign Het
Wdr62 T C 7: 30,242,874 Y1051C probably benign Het
Xpnpep3 A G 15: 81,430,714 D205G probably damaging Het
Zdhhc14 T C 17: 5,725,336 probably benign Het
Zfp607a A T 7: 27,879,212 D569V possibly damaging Het
Zfp609 C T 9: 65,701,188 E1137K possibly damaging Het
Zfp871 T C 17: 32,774,434 Y589C probably damaging Het
Zzef1 A T 11: 72,880,624 D1644V probably benign Het
Other mutations in Sart1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Sart1 APN 19 5383951 missense probably benign 0.00
IGL02390:Sart1 APN 19 5380461 missense possibly damaging 0.85
IGL02533:Sart1 APN 19 5383721 nonsense probably null
IGL03094:Sart1 APN 19 5384081 splice site probably benign
R0219:Sart1 UTSW 19 5388396 missense probably benign
R0226:Sart1 UTSW 19 5381122 splice site probably benign
R0537:Sart1 UTSW 19 5381724 missense probably damaging 0.99
R0668:Sart1 UTSW 19 5384256 missense probably damaging 1.00
R1574:Sart1 UTSW 19 5380259 missense probably damaging 1.00
R1574:Sart1 UTSW 19 5380259 missense probably damaging 1.00
R1674:Sart1 UTSW 19 5385825 missense probably damaging 0.99
R4077:Sart1 UTSW 19 5382743 missense possibly damaging 0.48
R4866:Sart1 UTSW 19 5382220 missense probably damaging 1.00
R5081:Sart1 UTSW 19 5388548 missense possibly damaging 0.72
R5523:Sart1 UTSW 19 5383676 missense probably damaging 0.99
R5756:Sart1 UTSW 19 5380469 missense probably damaging 1.00
R5875:Sart1 UTSW 19 5383795 missense probably damaging 1.00
R5979:Sart1 UTSW 19 5381223 missense probably damaging 1.00
R7360:Sart1 UTSW 19 5383203 missense probably damaging 0.96
R7560:Sart1 UTSW 19 5384877 missense probably damaging 0.97
R7764:Sart1 UTSW 19 5388585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCCACTGAGCACGATATACG -3'
(R):5'- TGGCATTAACTCCAGCTCCCAGAG -3'

Sequencing Primer
(F):5'- AGCACGATATACGGTGTCTTC -3'
(R):5'- CCTGGATTCTTttttggtttttcg -3'
Posted On2013-05-23