Mutagenetix > Incidental Mutations

Incidental Mutation 'R4905:Nos3'

378092

Institutional Source

Beutler Lab

Gene Symbol

Nos3

Ensembl Gene

ENSMUSG00000028978

Gene Name

nitric oxide synthase 3, endothelial cell

Synonyms

eNOS, 2310065A03Rik, ecNOS, Nos-3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4905 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24364810-24384474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24367331 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 134 (Y134F)

Ref Sequence

ENSEMBL: ENSMUSP00000110742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]

Predicted Effect

probably benign
Transcript: ENSMUST00000030834
AA Change: Y134F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: Y134F

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	118	480	1.7e-183	PFAM
Pfam:Flavodoxin_1	521	697	4.8e-54	PFAM
Pfam:FAD_binding_1	750	978	2.1e-82	PFAM
Pfam:NAD_binding_1	1010	1124	1.9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115090
AA Change: Y134F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: Y134F

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	114	485	9e-214	PFAM
Pfam:Flavodoxin_1	521	697	3.8e-54	PFAM
Pfam:FAD_binding_1	750	978	1.6e-79	PFAM
Pfam:NAD_binding_1	1010	1091	5.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156403

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	T	10: 100,612,818		probably null	Het
1700123L14Rik	T	A	6: 96,165,930	R44S	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
9530053A07Rik	A	T	7: 28,156,983	K2065M	possibly damaging	Het
Abcc5	A	G	16: 20,399,928	S235P	probably damaging	Het
Abcc6	T	C	7: 45,995,225	N842S	probably benign	Het
Acbd6	G	A	1: 155,624,923	V210I	probably benign	Het
Ahctf1	A	T	1: 179,748,627	V2130D	probably damaging	Het
Akap5	A	G	12: 76,328,433	E213G	probably damaging	Het
Alyref	T	G	11: 120,596,053		probably null	Het
Anapc5	G	T	5: 122,817,910	N152K	probably benign	Het
Atp8b2	A	T	3: 89,949,008	D416E	probably benign	Het
AW551984	A	T	9: 39,597,158	V354E	probably damaging	Het
Bag6	A	G	17: 35,145,186	E844G	probably damaging	Het
Bmp1	C	T	14: 70,491,362	R590H	probably benign	Het
Ccnh	T	C	13: 85,206,135	S233P	possibly damaging	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Col6a6	A	G	9: 105,767,424	S1222P	probably damaging	Het
Dhfr	G	A	13: 92,365,774	G118S	probably damaging	Het
Dnah9	G	A	11: 65,874,124	R1414*	probably null	Het
Dnaic1	A	G	4: 41,614,269	D315G	probably benign	Het
Eogt	T	C	6: 97,142,831	R139G	probably benign	Het
Fh1	C	T	1: 175,619,073	G79E	probably damaging	Het
Gabrg3	A	G	7: 56,724,556	Y421H	probably damaging	Het
Glipr1	C	A	10: 111,985,640	R219L	probably damaging	Het
Gm1123	T	C	9: 99,009,316	D360G	probably benign	Het
Ift81	C	T	5: 122,591,079		probably null	Het
Itsn2	A	G	12: 4,634,583		probably benign	Het
Kri1	A	T	9: 21,287,702	H55Q	probably benign	Het
Mcidas	C	A	13: 112,994,417	A92E	possibly damaging	Het
Mcidas	C	T	13: 112,997,504	T174M	possibly damaging	Het
Mmp25	C	A	17: 23,644,048	G130*	probably null	Het
Myh11	G	A	16: 14,250,523	T211M	probably benign	Het
Myo10	A	G	15: 25,800,212	D1458G	probably damaging	Het
Ncf4	A	G	15: 78,254,904	T154A	probably damaging	Het
Nfatc4	T	C	14: 55,830,582	I620T	probably benign	Het
Olfr1459	C	A	19: 13,146,177	A161S	probably benign	Het
Olfr273	T	C	4: 52,855,613	N300S	probably damaging	Het
Olfr575	A	T	7: 102,955,514	I36N	probably damaging	Het
Olfr799	T	A	10: 129,647,923	V265E	possibly damaging	Het
Pax9	G	T	12: 56,696,626	R19S	probably damaging	Het
Pcdha9	T	C	18: 36,998,892	I338T	probably damaging	Het
Plxnb2	G	T	15: 89,157,411	T1730K	probably damaging	Het
Rac1	A	G	5: 143,517,152		probably null	Het
Samsn1	G	T	16: 75,876,465	F174L	possibly damaging	Het
Scaf1	G	A	7: 45,012,705	T86M	probably damaging	Het
Smc1b	A	G	15: 85,066,227	Y1199H	probably damaging	Het
Svep1	A	G	4: 58,069,308	I2826T	probably benign	Het
Tex36	A	G	7: 133,587,453	V130A	probably damaging	Het
Tigd5	A	G	15: 75,911,403	H538R	probably damaging	Het
Tlr3	C	A	8: 45,399,223		probably null	Het
Tubb2b	A	T	13: 34,128,204	I202N	probably damaging	Het
Unc13c	A	G	9: 73,680,392	V1453A	probably benign	Het
Unc5c	A	T	3: 141,801,310	T608S	probably benign	Het
Vrk1	C	A	12: 106,051,828	H119N	probably damaging	Het
Wdr53	T	A	16: 32,256,658	M227K	probably benign	Het
Xpo4	T	C	14: 57,638,289	D129G	possibly damaging	Het
Zcchc4	T	C	5: 52,796,650	I224T	probably damaging	Het
Zdhhc1	T	A	8: 105,483,694	E30D	probably damaging	Het
Zscan29	C	G	2: 121,161,383	R540T	possibly damaging	Het

Other mutations in Nos3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00903:Nos3	APN	5	24369862	missense	probably damaging	1.00
IGL02059:Nos3	APN	5	24368998	missense	probably damaging	1.00
IGL02354:Nos3	APN	5	24367623	missense	probably damaging	1.00
IGL02361:Nos3	APN	5	24367623	missense	probably damaging	1.00
IGL02936:Nos3	APN	5	24380993	missense	probably damaging	0.97
IGL03190:Nos3	APN	5	24383629	missense	probably damaging	1.00
paul	UTSW	5	24372704	missense	probably damaging	1.00
Peter	UTSW	5	24377855	missense	probably damaging	0.99
R0111:Nos3	UTSW	5	24372704	missense	probably damaging	1.00
R0387:Nos3	UTSW	5	24367585	missense	probably damaging	1.00
R0755:Nos3	UTSW	5	24367297	missense	probably damaging	1.00
R1156:Nos3	UTSW	5	24377619	missense	probably benign	0.21
R1597:Nos3	UTSW	5	24368997	missense	probably damaging	1.00
R1671:Nos3	UTSW	5	24383840	missense	probably damaging	1.00
R1743:Nos3	UTSW	5	24377312	missense	probably benign	0.22
R1830:Nos3	UTSW	5	24370133	missense	probably damaging	1.00
R1882:Nos3	UTSW	5	24368820	missense	probably damaging	1.00
R2294:Nos3	UTSW	5	24364857	missense	probably damaging	0.99
R3114:Nos3	UTSW	5	24372631	splice site	probably benign
R3978:Nos3	UTSW	5	24377931	missense	probably damaging	1.00
R3980:Nos3	UTSW	5	24377931	missense	probably damaging	1.00
R4016:Nos3	UTSW	5	24371716	missense	probably damaging	1.00
R4947:Nos3	UTSW	5	24377855	missense	probably damaging	0.99
R5017:Nos3	UTSW	5	24366719	intron	probably benign
R5095:Nos3	UTSW	5	24368918	splice site	probably benign
R5096:Nos3	UTSW	5	24371957	missense	probably damaging	1.00
R5102:Nos3	UTSW	5	24371627	missense	probably damaging	1.00
R5311:Nos3	UTSW	5	24377345	missense	probably benign	0.19
R5330:Nos3	UTSW	5	24369904	missense	probably damaging	1.00
R5367:Nos3	UTSW	5	24371944	missense	probably benign	0.00
R5394:Nos3	UTSW	5	24383890	missense	probably benign	0.00
R5574:Nos3	UTSW	5	24368861	missense	possibly damaging	0.80
R5889:Nos3	UTSW	5	24368777	intron	probably benign
R6032:Nos3	UTSW	5	24379811	missense	probably benign
R6032:Nos3	UTSW	5	24379811	missense	probably benign
R6401:Nos3	UTSW	5	24379811	missense	probably benign
R6517:Nos3	UTSW	5	24383624	missense	probably damaging	1.00
R6888:Nos3	UTSW	5	24383335	missense	possibly damaging	0.86
R6972:Nos3	UTSW	5	24380243	missense	probably benign
R6973:Nos3	UTSW	5	24380243	missense	probably benign
R7432:Nos3	UTSW	5	24367615	missense	probably damaging	0.98
R7434:Nos3	UTSW	5	24382635	missense	probably damaging	0.99
R7507:Nos3	UTSW	5	24372644	missense	probably damaging	1.00
R7553:Nos3	UTSW	5	24381717	missense	possibly damaging	0.62
R7652:Nos3	UTSW	5	24383612	missense	probably damaging	1.00
R8094:Nos3	UTSW	5	24367220	missense	probably benign	0.13
X0020:Nos3	UTSW	5	24370124	missense	probably damaging	1.00
X0061:Nos3	UTSW	5	24382635	missense	probably damaging	0.99
Z1176:Nos3	UTSW	5	24377654	missense	probably benign	0.02
Z1177:Nos3	UTSW	5	24383950	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCATTATCAGCCCTGCTCTGAG -3'
(R):5'- TCAGCCTCCACTTCCTGAAG -3'

Sequencing Primer
(F):5'- CTGTACTATGACCTGATCCTGG -3'
(R):5'- ACTTCCTGAAGCCGCTGC -3'

Posted On

2016-04-15