Incidental Mutation 'R4905:Eogt'
ID378099
Institutional Source Beutler Lab
Gene Symbol Eogt
Ensembl Gene ENSMUSG00000035245
Gene NameEGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
SynonymsA130022J15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4905 (G1)
Quality Score85
Status Not validated
Chromosome6
Chromosomal Location97110024-97149182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97142831 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 139 (R139G)
Ref Sequence ENSEMBL: ENSMUSP00000117541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054344] [ENSMUST00000113387] [ENSMUST00000136575] [ENSMUST00000142116] [ENSMUST00000142553] [ENSMUST00000204331]
Predicted Effect probably benign
Transcript: ENSMUST00000054344
AA Change: R139G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000061610
Gene: ENSMUSG00000035245
AA Change: R139G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF563 245 472 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113387
SMART Domains Protein: ENSMUSP00000109014
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135187
Predicted Effect probably benign
Transcript: ENSMUST00000136575
AA Change: R139G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117541
Gene: ENSMUSG00000035245
AA Change: R139G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142116
Predicted Effect probably benign
Transcript: ENSMUST00000142553
SMART Domains Protein: ENSMUSP00000115101
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204331
SMART Domains Protein: ENSMUSP00000145303
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that acts in the lumen of the endoplasmic reticulum to catalyze the transfer of N-acetylglucosamine to serine or threonine residues of extracellular-targeted proteins. This enzyme modifies proteins containing eukaryotic growth factor (EGF)-like domains, including the Notch receptor, thereby regulating developmental signalling. Mutations in this gene have been observed in individuals with Adams-Oliver syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Gabrg3 A G 7: 56,724,556 Y421H probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Mmp25 C A 17: 23,644,048 G130* probably null Het
Myh11 G A 16: 14,250,523 T211M probably benign Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Smc1b A G 15: 85,066,227 Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Vrk1 C A 12: 106,051,828 H119N probably damaging Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Zscan29 C G 2: 121,161,383 R540T possibly damaging Het
Other mutations in Eogt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Eogt APN 6 97120000 missense probably damaging 0.97
IGL01292:Eogt APN 6 97144027 missense possibly damaging 0.88
IGL02332:Eogt APN 6 97125605 missense probably damaging 1.00
IGL02439:Eogt APN 6 97143973 missense possibly damaging 0.83
R0019:Eogt UTSW 6 97134273 unclassified probably benign
R0112:Eogt UTSW 6 97135284 splice site probably benign
R0325:Eogt UTSW 6 97113955 missense probably damaging 0.99
R0497:Eogt UTSW 6 97135233 missense probably benign 0.00
R0730:Eogt UTSW 6 97116009 nonsense probably null
R1730:Eogt UTSW 6 97113864 missense probably damaging 1.00
R1783:Eogt UTSW 6 97113864 missense probably damaging 1.00
R2074:Eogt UTSW 6 97131376 missense probably benign 0.02
R2279:Eogt UTSW 6 97134301 missense probably benign 0.28
R2679:Eogt UTSW 6 97120800 missense probably benign 0.01
R2993:Eogt UTSW 6 97118954 splice site probably null
R3176:Eogt UTSW 6 97131394 missense probably benign 0.21
R3276:Eogt UTSW 6 97131394 missense probably benign 0.21
R3876:Eogt UTSW 6 97120190 missense probably damaging 0.99
R3940:Eogt UTSW 6 97113914 missense probably damaging 1.00
R4613:Eogt UTSW 6 97134304 missense probably benign 0.00
R4704:Eogt UTSW 6 97113852 missense probably damaging 0.99
R4849:Eogt UTSW 6 97116055 missense probably damaging 0.99
R4867:Eogt UTSW 6 97120147 intron probably benign
R5120:Eogt UTSW 6 97134315 missense probably benign
R5143:Eogt UTSW 6 97125584 missense probably damaging 1.00
R5594:Eogt UTSW 6 97116035 missense probably benign 0.01
R6351:Eogt UTSW 6 97120194 missense probably damaging 1.00
R6418:Eogt UTSW 6 97145392 missense possibly damaging 0.77
R6498:Eogt UTSW 6 97135213 missense probably damaging 1.00
R6950:Eogt UTSW 6 97134382 missense possibly damaging 0.77
R7114:Eogt UTSW 6 97116004 missense probably damaging 1.00
R7185:Eogt UTSW 6 97120178 missense probably damaging 1.00
R7221:Eogt UTSW 6 97112724 missense probably damaging 1.00
R7232:Eogt UTSW 6 97119983 missense probably damaging 0.98
R7467:Eogt UTSW 6 97142833 missense probably benign 0.01
R7526:Eogt UTSW 6 97113952 missense probably damaging 1.00
R7672:Eogt UTSW 6 97113909 missense probably damaging 1.00
R7851:Eogt UTSW 6 97120201 missense probably benign 0.01
R7934:Eogt UTSW 6 97120201 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTTGAGTCCCAATGTAACCACAC -3'
(R):5'- TTCCAGGGGATCTGATGCCT -3'

Sequencing Primer
(F):5'- ACACGACTCGCTTGTTAGAG -3'
(R):5'- GCATTCATATGGCGGCAC -3'
Posted On2016-04-15