Incidental Mutation 'R4905:Gabrg3'
ID378103
Institutional Source Beutler Lab
Gene Symbol Gabrg3
Ensembl Gene ENSMUSG00000055026
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 3
SynonymsGabrg-3, B230362M20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4905 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location56716465-57387188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56724556 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 421 (Y421H)
Ref Sequence ENSEMBL: ENSMUSP00000067632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068911]
Predicted Effect probably damaging
Transcript: ENSMUST00000068911
AA Change: Y421H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067632
Gene: ENSMUSG00000055026
AA Change: Y421H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 47 253 2.9e-51 PFAM
Pfam:Neur_chan_memb 260 461 1.4e-39 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Eogt T C 6: 97,142,831 R139G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Mmp25 C A 17: 23,644,048 G130* probably null Het
Myh11 G A 16: 14,250,523 T211M probably benign Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Smc1b A G 15: 85,066,227 Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Vrk1 C A 12: 106,051,828 H119N probably damaging Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Zscan29 C G 2: 121,161,383 R540T possibly damaging Het
Other mutations in Gabrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Gabrg3 APN 7 57381667 missense probably damaging 0.99
IGL01501:Gabrg3 APN 7 56724466 missense probably damaging 0.99
IGL02637:Gabrg3 APN 7 56735027 missense probably damaging 0.99
IGL02707:Gabrg3 APN 7 56982691 nonsense probably null
IGL03084:Gabrg3 APN 7 56735064 missense possibly damaging 0.91
IGL03237:Gabrg3 APN 7 56982712 splice site probably null
IGL03275:Gabrg3 APN 7 56773347 missense probably damaging 1.00
IGL03309:Gabrg3 APN 7 56982685 missense probably damaging 1.00
R0265:Gabrg3 UTSW 7 57381617 nonsense probably null
R0612:Gabrg3 UTSW 7 56729706 missense probably damaging 0.99
R0627:Gabrg3 UTSW 7 56724595 missense probably damaging 0.99
R0676:Gabrg3 UTSW 7 56724421 missense probably damaging 0.99
R1178:Gabrg3 UTSW 7 56735091 missense probably benign 0.01
R1600:Gabrg3 UTSW 7 56735074 nonsense probably null
R1702:Gabrg3 UTSW 7 56985100 missense probably damaging 0.98
R1836:Gabrg3 UTSW 7 56729641 missense probably damaging 1.00
R2327:Gabrg3 UTSW 7 56735087 missense probably benign 0.01
R3816:Gabrg3 UTSW 7 57381664 nonsense probably null
R3818:Gabrg3 UTSW 7 57381664 nonsense probably null
R3819:Gabrg3 UTSW 7 57381664 nonsense probably null
R5643:Gabrg3 UTSW 7 56773284 missense possibly damaging 0.95
R6088:Gabrg3 UTSW 7 56985078 missense probably damaging 1.00
R6862:Gabrg3 UTSW 7 56773311 missense possibly damaging 0.54
R6879:Gabrg3 UTSW 7 57381639 missense probably damaging 1.00
R7075:Gabrg3 UTSW 7 57323696 missense probably damaging 0.99
R7305:Gabrg3 UTSW 7 56735085 missense probably benign 0.01
R7594:Gabrg3 UTSW 7 56982695 missense possibly damaging 0.90
R7793:Gabrg3 UTSW 7 57179580 missense probably benign 0.00
R7886:Gabrg3 UTSW 7 56724481 missense probably damaging 1.00
R7969:Gabrg3 UTSW 7 56724481 missense probably damaging 1.00
R8002:Gabrg3 UTSW 7 56734968 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTCAGTCATCCCTCAGAGC -3'
(R):5'- GCGTCCATCTAGTCTAGTAGCAG -3'

Sequencing Primer
(F):5'- GCAGCACTTAAAGATACAGGTATC -3'
(R):5'- CCATCTAGTCTAGTAGCAGACAGAAG -3'
Posted On2016-04-15