Incidental Mutation 'R4905:Vrk1'
ID378124
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Namevaccinia related kinase 1
Synonyms51PK
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R4905 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location106010228-106077426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106051828 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 119 (H119N)
Ref Sequence ENSEMBL: ENSMUSP00000152109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312]
Predicted Effect probably damaging
Transcript: ENSMUST00000021539
AA Change: H119N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115
AA Change: H119N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072040
AA Change: H119N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115
AA Change: H119N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085026
AA Change: H119N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115
AA Change: H119N

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220629
AA Change: H119N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000221312
AA Change: H119N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Eogt T C 6: 97,142,831 R139G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Gabrg3 A G 7: 56,724,556 Y421H probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Mmp25 C A 17: 23,644,048 G130* probably null Het
Myh11 G A 16: 14,250,523 T211M probably benign Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Smc1b A G 15: 85,066,227 Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Zscan29 C G 2: 121,161,383 R540T possibly damaging Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106058581 missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106055916 splice site probably null
IGL02072:Vrk1 APN 12 106042885 missense probably benign 0.04
IGL02387:Vrk1 APN 12 106070544 missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106051002 missense probably benign 0.00
IGL02501:Vrk1 APN 12 106062653 missense probably benign
IGL03211:Vrk1 APN 12 106036588 missense probably benign 0.03
R0332:Vrk1 UTSW 12 106058625 missense probably benign 0.05
R0790:Vrk1 UTSW 12 106070624 missense probably benign
R1897:Vrk1 UTSW 12 106036540 splice site probably benign
R1911:Vrk1 UTSW 12 106057977 critical splice donor site probably null
R2289:Vrk1 UTSW 12 106057861 missense probably damaging 1.00
R2981:Vrk1 UTSW 12 106051793 missense probably damaging 1.00
R4885:Vrk1 UTSW 12 106057972 missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106073606 splice site probably null
R5366:Vrk1 UTSW 12 106055819 missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106051765 missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106058651 missense probably damaging 1.00
R6907:Vrk1 UTSW 12 106075032 missense possibly damaging 0.90
R8154:Vrk1 UTSW 12 106070534 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGCAGTTTCAAGATAGGTAACAGC -3'
(R):5'- TTAACAGGCCCCTGACACTG -3'

Sequencing Primer
(F):5'- TTTCAAGATAGGTAACAGCAGGGTG -3'
(R):5'- CACTGTGGTGTACTGAGAACAAC -3'
Posted On2016-04-15