Incidental Mutation 'R4905:Smc1b'
ID378136
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Namestructural maintenance of chromosomes 1B
SynonymsSMC1beta, Smc1l2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R4905 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85064689-85131964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85066227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1199 (Y1199H)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000023069] [ENSMUST00000227591] [ENSMUST00000229203]
Predicted Effect probably damaging
Transcript: ENSMUST00000023068
AA Change: Y1199H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: Y1199H

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023069
SMART Domains Protein: ENSMUSP00000023069
Gene: ENSMUSG00000022434

DomainStartEndE-ValueType
Pfam:SIR2_2 142 286 7.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Predicted Effect probably benign
Transcript: ENSMUST00000229203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229691
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Eogt T C 6: 97,142,831 R139G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Gabrg3 A G 7: 56,724,556 Y421H probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Mmp25 C A 17: 23,644,048 G130* probably null Het
Myh11 G A 16: 14,250,523 T211M probably benign Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Vrk1 C A 12: 106,051,828 H119N probably damaging Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Zscan29 C G 2: 121,161,383 R540T possibly damaging Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85129700 missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85131898 missense probably damaging 1.00
IGL01656:Smc1b APN 15 85114776 missense probably damaging 0.99
IGL01807:Smc1b APN 15 85096745 missense probably damaging 0.97
IGL02094:Smc1b APN 15 85097891 splice site probably benign
IGL02121:Smc1b APN 15 85097985 missense probably benign
IGL02631:Smc1b APN 15 85107003 missense probably damaging 0.98
IGL02678:Smc1b APN 15 85065000 nonsense probably null
IGL03197:Smc1b APN 15 85070863 missense possibly damaging 0.85
IGL03214:Smc1b APN 15 85097946 nonsense probably null
IGL03218:Smc1b APN 15 85089713 missense probably benign 0.07
IGL03232:Smc1b APN 15 85129720 missense possibly damaging 0.68
adamantine UTSW 15 85121641 missense probably benign 0.06
unbreakable UTSW 15 85096658 missense probably benign
E0370:Smc1b UTSW 15 85127581 missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 85069651 missense possibly damaging 0.91
R0092:Smc1b UTSW 15 85067724 unclassified probably benign
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0207:Smc1b UTSW 15 85123759 missense probably benign
R0390:Smc1b UTSW 15 85066277 missense probably damaging 1.00
R0440:Smc1b UTSW 15 85112673 splice site probably benign
R0685:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R1109:Smc1b UTSW 15 85112815 missense probably damaging 0.98
R1392:Smc1b UTSW 15 85107070 splice site probably benign
R1509:Smc1b UTSW 15 85086134 missense probably benign
R1804:Smc1b UTSW 15 85127790 missense possibly damaging 0.90
R1879:Smc1b UTSW 15 85092067 missense probably benign 0.01
R2086:Smc1b UTSW 15 85121851 splice site probably benign
R2143:Smc1b UTSW 15 85123802 missense probably benign
R2158:Smc1b UTSW 15 85121851 splice site probably benign
R2174:Smc1b UTSW 15 85121851 splice site probably benign
R2471:Smc1b UTSW 15 85092017 missense probably damaging 0.98
R3689:Smc1b UTSW 15 85117263 intron probably benign
R3690:Smc1b UTSW 15 85117263 intron probably benign
R4178:Smc1b UTSW 15 85120647 missense possibly damaging 0.94
R4420:Smc1b UTSW 15 85112830 missense probably damaging 1.00
R4919:Smc1b UTSW 15 85117104 intron probably benign
R5114:Smc1b UTSW 15 85064984 missense probably damaging 1.00
R5314:Smc1b UTSW 15 85070865 missense probably benign 0.00
R5476:Smc1b UTSW 15 85086151 missense probably damaging 0.97
R5593:Smc1b UTSW 15 85121641 missense probably benign 0.06
R5690:Smc1b UTSW 15 85112773 missense probably damaging 1.00
R5719:Smc1b UTSW 15 85096658 missense probably benign
R5817:Smc1b UTSW 15 85067783 missense probably damaging 0.99
R5834:Smc1b UTSW 15 85089665 missense probably damaging 1.00
R5930:Smc1b UTSW 15 85086121 missense probably damaging 1.00
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85121695 missense probably damaging 1.00
R6306:Smc1b UTSW 15 85127623 missense probably benign 0.30
R6392:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6426:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6435:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6436:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6437:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6508:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6512:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6703:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6737:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6775:Smc1b UTSW 15 85089680 missense probably damaging 0.96
R6889:Smc1b UTSW 15 85067759 missense probably damaging 1.00
R6908:Smc1b UTSW 15 85107010 missense probably damaging 1.00
R7124:Smc1b UTSW 15 85071597 missense probably damaging 0.98
R7400:Smc1b UTSW 15 85069720 missense probably damaging 1.00
R7417:Smc1b UTSW 15 85097542 missense probably benign 0.05
R7610:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R7873:Smc1b UTSW 15 85110650 critical splice donor site probably null
R7890:Smc1b UTSW 15 85066328 missense probably damaging 1.00
R8004:Smc1b UTSW 15 85097614 missense probably damaging 0.98
Z1176:Smc1b UTSW 15 85131903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATATTTACTCGTGTGTGGGG -3'
(R):5'- TTGTTCCCAGAGCCCAAAGG -3'

Sequencing Primer
(F):5'- ACGTGGGTCTCAGTGATCAAACTC -3'
(R):5'- AGCCCAAAGGAGGCCTTG -3'
Posted On2016-04-15