Mutagenetix > Incidental Mutation

Incidental Mutation 'R4905:Plxnb2'

378137

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R4905 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 89157411 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1730 (T1730K)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

probably damaging
Transcript: ENSMUST00000060808
AA Change: T1730K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: T1730K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109331
AA Change: T1730K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: T1730K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230393

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	T	10: 100,612,818		probably null	Het
1700123L14Rik	T	A	6: 96,165,930	R44S	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
9530053A07Rik	A	T	7: 28,156,983	K2065M	possibly damaging	Het
Abcc5	A	G	16: 20,399,928	S235P	probably damaging	Het
Abcc6	T	C	7: 45,995,225	N842S	probably benign	Het
Acbd6	G	A	1: 155,624,923	V210I	probably benign	Het
Ahctf1	A	T	1: 179,748,627	V2130D	probably damaging	Het
Akap5	A	G	12: 76,328,433	E213G	probably damaging	Het
Alyref	T	G	11: 120,596,053		probably null	Het
Anapc5	G	T	5: 122,817,910	N152K	probably benign	Het
Atp8b2	A	T	3: 89,949,008	D416E	probably benign	Het
AW551984	A	T	9: 39,597,158	V354E	probably damaging	Het
Bag6	A	G	17: 35,145,186	E844G	probably damaging	Het
Bmp1	C	T	14: 70,491,362	R590H	probably benign	Het
Ccnh	T	C	13: 85,206,135	S233P	possibly damaging	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Col6a6	A	G	9: 105,767,424	S1222P	probably damaging	Het
Dhfr	G	A	13: 92,365,774	G118S	probably damaging	Het
Dnah9	G	A	11: 65,874,124	R1414*	probably null	Het
Dnaic1	A	G	4: 41,614,269	D315G	probably benign	Het
Eogt	T	C	6: 97,142,831	R139G	probably benign	Het
Fh1	C	T	1: 175,619,073	G79E	probably damaging	Het
Gabrg3	A	G	7: 56,724,556	Y421H	probably damaging	Het
Glipr1	C	A	10: 111,985,640	R219L	probably damaging	Het
Gm1123	T	C	9: 99,009,316	D360G	probably benign	Het
Ift81	C	T	5: 122,591,079		probably null	Het
Itsn2	A	G	12: 4,634,583		probably benign	Het
Kri1	A	T	9: 21,287,702	H55Q	probably benign	Het
Mcidas	C	A	13: 112,994,417	A92E	possibly damaging	Het
Mcidas	C	T	13: 112,997,504	T174M	possibly damaging	Het
Mmp25	C	A	17: 23,644,048	G130*	probably null	Het
Myh11	G	A	16: 14,250,523	T211M	probably benign	Het
Myo10	A	G	15: 25,800,212	D1458G	probably damaging	Het
Ncf4	A	G	15: 78,254,904	T154A	probably damaging	Het
Nfatc4	T	C	14: 55,830,582	I620T	probably benign	Het
Nos3	A	T	5: 24,367,331	Y134F	probably benign	Het
Olfr1459	C	A	19: 13,146,177	A161S	probably benign	Het
Olfr273	T	C	4: 52,855,613	N300S	probably damaging	Het
Olfr575	A	T	7: 102,955,514	I36N	probably damaging	Het
Olfr799	T	A	10: 129,647,923	V265E	possibly damaging	Het
Pax9	G	T	12: 56,696,626	R19S	probably damaging	Het
Pcdha9	T	C	18: 36,998,892	I338T	probably damaging	Het
Rac1	A	G	5: 143,517,152		probably null	Het
Samsn1	G	T	16: 75,876,465	F174L	possibly damaging	Het
Scaf1	G	A	7: 45,012,705	T86M	probably damaging	Het
Smc1b	A	G	15: 85,066,227	Y1199H	probably damaging	Het
Svep1	A	G	4: 58,069,308	I2826T	probably benign	Het
Tex36	A	G	7: 133,587,453	V130A	probably damaging	Het
Tigd5	A	G	15: 75,911,403	H538R	probably damaging	Het
Tlr3	C	A	8: 45,399,223		probably null	Het
Tubb2b	A	T	13: 34,128,204	I202N	probably damaging	Het
Unc13c	A	G	9: 73,680,392	V1453A	probably benign	Het
Unc5c	A	T	3: 141,801,310	T608S	probably benign	Het
Vrk1	C	A	12: 106,051,828	H119N	probably damaging	Het
Wdr53	T	A	16: 32,256,658	M227K	probably benign	Het
Xpo4	T	C	14: 57,638,289	D129G	possibly damaging	Het
Zcchc4	T	C	5: 52,796,650	I224T	probably damaging	Het
Zdhhc1	T	A	8: 105,483,694	E30D	probably damaging	Het
Zscan29	C	G	2: 121,161,383	R540T	possibly damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9044:Plxnb2	UTSW	15	89160363	splice site	probably benign
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
R9562:Plxnb2	UTSW	15	89165933	missense	probably damaging	1.00
R9568:Plxnb2	UTSW	15	89160957	nonsense	probably null
R9613:Plxnb2	UTSW	15	89164293	missense	probably benign	0.01
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCTTAGCATACAACAGCTTG -3'
(R):5'- AAACCAACAGGTGAGGCTTC -3'

Sequencing Primer
(F):5'- CTTGTTGCTGGGAGAGTCC -3'
(R):5'- GCCCTGTCTGCCCCAAG -3'

Posted On

2016-04-15