Incidental Mutation 'R4905:Plxnb2'
ID 378137
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Name plexin B2
Synonyms 1110007H23Rik, Debt
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R4905 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 89039752-89064960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 89041614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1730 (T1730K)
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
AlphaFold B2RXS4
Predicted Effect probably damaging
Transcript: ENSMUST00000060808
AA Change: T1730K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: T1730K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109331
AA Change: T1730K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: T1730K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230393
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,448,680 (GRCm39) probably null Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Abcc5 A G 16: 20,218,678 (GRCm39) S235P probably damaging Het
Abcc6 T C 7: 45,644,649 (GRCm39) N842S probably benign Het
Acbd6 G A 1: 155,500,669 (GRCm39) V210I probably benign Het
Ahctf1 A T 1: 179,576,192 (GRCm39) V2130D probably damaging Het
Akap5 A G 12: 76,375,207 (GRCm39) E213G probably damaging Het
Alyref T G 11: 120,486,879 (GRCm39) probably null Het
Anapc5 G T 5: 122,955,973 (GRCm39) N152K probably benign Het
Atp8b2 A T 3: 89,856,315 (GRCm39) D416E probably benign Het
AW551984 A T 9: 39,508,454 (GRCm39) V354E probably damaging Het
Bag6 A G 17: 35,364,162 (GRCm39) E844G probably damaging Het
Bmp1 C T 14: 70,728,802 (GRCm39) R590H probably benign Het
Ccnh T C 13: 85,354,254 (GRCm39) S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,312,205 (GRCm39) probably benign Het
Col6a6 A G 9: 105,644,623 (GRCm39) S1222P probably damaging Het
Dhfr G A 13: 92,502,282 (GRCm39) G118S probably damaging Het
Dnah9 G A 11: 65,764,950 (GRCm39) R1414* probably null Het
Dnai1 A G 4: 41,614,269 (GRCm39) D315G probably benign Het
Eogt T C 6: 97,119,792 (GRCm39) R139G probably benign Het
Fcgbpl1 A T 7: 27,856,408 (GRCm39) K2065M possibly damaging Het
Fh1 C T 1: 175,446,639 (GRCm39) G79E probably damaging Het
Gabrg3 A G 7: 56,374,304 (GRCm39) Y421H probably damaging Het
Glipr1 C A 10: 111,821,545 (GRCm39) R219L probably damaging Het
Gm1123 T C 9: 98,891,369 (GRCm39) D360G probably benign Het
Ift81 C T 5: 122,729,142 (GRCm39) probably null Het
Itsn2 A G 12: 4,684,583 (GRCm39) probably benign Het
Kri1 A T 9: 21,198,998 (GRCm39) H55Q probably benign Het
Mcidas C T 13: 113,134,038 (GRCm39) T174M possibly damaging Het
Mcidas C A 13: 113,130,951 (GRCm39) A92E possibly damaging Het
Mmp25 C A 17: 23,863,022 (GRCm39) G130* probably null Het
Myh11 G A 16: 14,068,387 (GRCm39) T211M probably benign Het
Myo10 A G 15: 25,800,298 (GRCm39) D1458G probably damaging Het
Ncf4 A G 15: 78,139,104 (GRCm39) T154A probably damaging Het
Nfatc4 T C 14: 56,068,039 (GRCm39) I620T probably benign Het
Nos3 A T 5: 24,572,329 (GRCm39) Y134F probably benign Het
Nup50l T A 6: 96,142,911 (GRCm39) R44S possibly damaging Het
Or13c3 T C 4: 52,855,613 (GRCm39) N300S probably damaging Het
Or51a6 A T 7: 102,604,721 (GRCm39) I36N probably damaging Het
Or5b106 C A 19: 13,123,541 (GRCm39) A161S probably benign Het
Or6c209 T A 10: 129,483,792 (GRCm39) V265E possibly damaging Het
Pax9 G T 12: 56,743,411 (GRCm39) R19S probably damaging Het
Pcdha9 T C 18: 37,131,945 (GRCm39) I338T probably damaging Het
Rac1 A G 5: 143,502,907 (GRCm39) probably null Het
Samsn1 G T 16: 75,673,353 (GRCm39) F174L possibly damaging Het
Scaf1 G A 7: 44,662,129 (GRCm39) T86M probably damaging Het
Smc1b A G 15: 84,950,428 (GRCm39) Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 (GRCm39) I2826T probably benign Het
Tex36 A G 7: 133,189,182 (GRCm39) V130A probably damaging Het
Tigd5 A G 15: 75,783,252 (GRCm39) H538R probably damaging Het
Tlr3 C A 8: 45,852,260 (GRCm39) probably null Het
Tubb2b A T 13: 34,312,187 (GRCm39) I202N probably damaging Het
Unc13c A G 9: 73,587,674 (GRCm39) V1453A probably benign Het
Unc5c A T 3: 141,507,071 (GRCm39) T608S probably benign Het
Vrk1 C A 12: 106,018,087 (GRCm39) H119N probably damaging Het
Wdr53 T A 16: 32,075,476 (GRCm39) M227K probably benign Het
Xpo4 T C 14: 57,875,746 (GRCm39) D129G possibly damaging Het
Zcchc4 T C 5: 52,953,992 (GRCm39) I224T probably damaging Het
Zdhhc1 T A 8: 106,210,326 (GRCm39) E30D probably damaging Het
Zscan29 C G 2: 120,991,864 (GRCm39) R540T possibly damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89,046,569 (GRCm39) splice site probably benign
IGL01574:Plxnb2 APN 15 89,046,886 (GRCm39) splice site probably null
IGL01695:Plxnb2 APN 15 89,041,417 (GRCm39) missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89,046,184 (GRCm39) splice site probably null
IGL01921:Plxnb2 APN 15 89,048,474 (GRCm39) missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89,044,613 (GRCm39) missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89,050,016 (GRCm39) nonsense probably null
IGL02637:Plxnb2 APN 15 89,048,260 (GRCm39) missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89,045,425 (GRCm39) critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89,042,234 (GRCm39) missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89,046,641 (GRCm39) splice site probably benign
P0040:Plxnb2 UTSW 15 89,047,138 (GRCm39) missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89,047,479 (GRCm39) critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89,049,534 (GRCm39) missense probably benign
R0103:Plxnb2 UTSW 15 89,045,972 (GRCm39) missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89,042,816 (GRCm39) splice site probably benign
R0671:Plxnb2 UTSW 15 89,042,184 (GRCm39) missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89,046,524 (GRCm39) missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89,051,395 (GRCm39) missense probably benign
R1542:Plxnb2 UTSW 15 89,050,124 (GRCm39) missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89,042,696 (GRCm39) missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89,046,665 (GRCm39) missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89,046,187 (GRCm39) critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89,042,971 (GRCm39) missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89,042,971 (GRCm39) missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89,047,013 (GRCm39) nonsense probably null
R2049:Plxnb2 UTSW 15 89,043,205 (GRCm39) missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89,042,654 (GRCm39) missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89,042,229 (GRCm39) missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89,040,765 (GRCm39) missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89,045,272 (GRCm39) missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89,045,272 (GRCm39) missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89,041,458 (GRCm39) splice site probably benign
R3825:Plxnb2 UTSW 15 89,050,602 (GRCm39) missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89,043,845 (GRCm39) missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89,041,221 (GRCm39) missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89,044,826 (GRCm39) missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89,047,006 (GRCm39) missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89,045,131 (GRCm39) missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89,041,622 (GRCm39) nonsense probably null
R4773:Plxnb2 UTSW 15 89,051,150 (GRCm39) missense probably benign 0.06
R5368:Plxnb2 UTSW 15 89,043,796 (GRCm39) missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89,050,694 (GRCm39) missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89,048,412 (GRCm39) splice site probably null
R5520:Plxnb2 UTSW 15 89,051,746 (GRCm39) missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89,048,223 (GRCm39) missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89,041,638 (GRCm39) missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89,047,012 (GRCm39) missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89,051,235 (GRCm39) missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89,042,899 (GRCm39) missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89,051,774 (GRCm39) missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89,044,962 (GRCm39) missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89,051,775 (GRCm39) missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89,045,225 (GRCm39) missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89,042,203 (GRCm39) missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89,051,461 (GRCm39) missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89,049,494 (GRCm39) missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89,046,189 (GRCm39) missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89,044,916 (GRCm39) missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89,041,973 (GRCm39) missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89,048,629 (GRCm39) missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89,048,523 (GRCm39) missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89,044,592 (GRCm39) missense probably benign
R7354:Plxnb2 UTSW 15 89,049,928 (GRCm39) missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89,042,525 (GRCm39) critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89,045,977 (GRCm39) missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89,046,533 (GRCm39) missense probably benign
R7766:Plxnb2 UTSW 15 89,045,474 (GRCm39) missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89,041,225 (GRCm39) missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89,047,506 (GRCm39) missense probably benign
R8131:Plxnb2 UTSW 15 89,042,916 (GRCm39) missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89,042,696 (GRCm39) missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89,046,261 (GRCm39) missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89,046,949 (GRCm39) missense probably damaging 1.00
R9022:Plxnb2 UTSW 15 89,048,471 (GRCm39) missense possibly damaging 0.59
R9044:Plxnb2 UTSW 15 89,044,566 (GRCm39) splice site probably benign
R9253:Plxnb2 UTSW 15 89,052,015 (GRCm39) missense probably benign
R9398:Plxnb2 UTSW 15 89,045,122 (GRCm39) missense probably benign 0.02
R9562:Plxnb2 UTSW 15 89,050,136 (GRCm39) missense probably damaging 1.00
R9568:Plxnb2 UTSW 15 89,045,160 (GRCm39) nonsense probably null
R9613:Plxnb2 UTSW 15 89,048,496 (GRCm39) missense probably benign 0.01
X0027:Plxnb2 UTSW 15 89,044,916 (GRCm39) missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89,043,299 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTTAGCATACAACAGCTTG -3'
(R):5'- AAACCAACAGGTGAGGCTTC -3'

Sequencing Primer
(F):5'- CTTGTTGCTGGGAGAGTCC -3'
(R):5'- GCCCTGTCTGCCCCAAG -3'
Posted On 2016-04-15