Incidental Mutation 'R4905:Mmp25'
ID378141
Institutional Source Beutler Lab
Gene Symbol Mmp25
Ensembl Gene ENSMUSG00000023903
Gene Namematrix metallopeptidase 25
SynonymsLeukolysin, MT6-MMP, F730048C11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4905 (G1)
Quality Score187
Status Not validated
Chromosome17
Chromosomal Location23629458-23645269 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 23644048 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 130 (G130*)
Ref Sequence ENSEMBL: ENSMUSP00000024696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024696]
Predicted Effect probably null
Transcript: ENSMUST00000024696
AA Change: G130*
SMART Domains Protein: ENSMUSP00000024696
Gene: ENSMUSG00000023903
AA Change: G130*

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:PG_binding_1 82 140 8.8e-12 PFAM
ZnMc 166 335 1.68e-47 SMART
low complexity region 343 369 N/A INTRINSIC
HX 375 419 6.35e-8 SMART
HX 424 466 1.62e-5 SMART
HX 470 516 1.64e-10 SMART
HX 518 562 2.79e-4 SMART
low complexity region 572 581 N/A INTRINSIC
low complexity region 597 607 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded precursor undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Eogt T C 6: 97,142,831 R139G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Gabrg3 A G 7: 56,724,556 Y421H probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Myh11 G A 16: 14,250,523 T211M probably benign Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Smc1b A G 15: 85,066,227 Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Vrk1 C A 12: 106,051,828 H119N probably damaging Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Zscan29 C G 2: 121,161,383 R540T possibly damaging Het
Other mutations in Mmp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Mmp25 APN 17 23639762 missense probably damaging 1.00
IGL02893:Mmp25 APN 17 23644051 missense probably damaging 1.00
R0471:Mmp25 UTSW 17 23639884 missense possibly damaging 0.73
R0478:Mmp25 UTSW 17 23632782 missense probably benign 0.08
R1829:Mmp25 UTSW 17 23640023 missense probably benign 0.00
R2005:Mmp25 UTSW 17 23640242 missense probably damaging 1.00
R2151:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R2153:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R2154:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R2937:Mmp25 UTSW 17 23644791 missense probably benign 0.00
R4418:Mmp25 UTSW 17 23644070 missense probably damaging 1.00
R4667:Mmp25 UTSW 17 23644607 missense probably benign 0.00
R5535:Mmp25 UTSW 17 23644760 missense probably benign
R5592:Mmp25 UTSW 17 23640202 missense possibly damaging 0.95
R5888:Mmp25 UTSW 17 23631074 missense probably damaging 1.00
R6261:Mmp25 UTSW 17 23630794 missense possibly damaging 0.61
R6263:Mmp25 UTSW 17 23630794 missense possibly damaging 0.61
R6264:Mmp25 UTSW 17 23630794 missense possibly damaging 0.61
R6571:Mmp25 UTSW 17 23639896 missense probably benign 0.17
R7172:Mmp25 UTSW 17 23644788 missense probably benign
R7467:Mmp25 UTSW 17 23644782 missense possibly damaging 0.53
T0722:Mmp25 UTSW 17 23631218 missense possibly damaging 0.94
Z1176:Mmp25 UTSW 17 23630659 missense probably damaging 1.00
Z1177:Mmp25 UTSW 17 23644137 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CGGTTTAAAGACTCCGAGCC -3'
(R):5'- GGAAAGCCCCATCCTTTTAGAG -3'

Sequencing Primer
(F):5'- GTTTAAAGACTCCGAGCCATGCTG -3'
(R):5'- AGAGTTTCATCAATCCTATCCTGTG -3'
Posted On2016-04-15