Mutagenetix > Incidental Mutations

Incidental Mutation 'R4906:Cspp1'

378146

Institutional Source

Beutler Lab

Gene Symbol

Cspp1

Ensembl Gene

ENSMUSG00000056763

Gene Name

centrosome and spindle pole associated protein 1

Synonyms

2310020J12Rik, 4930413O22Rik

MMRRC Submission

042508-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R4906 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10037987-10136768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10082328 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 368 (Q368R)

Ref Sequence

ENSEMBL: ENSMUSP00000139775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000186294]

Predicted Effect

probably benign
Transcript: ENSMUST00000071087
AA Change: Q372R

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763
AA Change: Q372R

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
low complexity region	270	285	N/A	INTRINSIC
coiled coil region	349	383	N/A	INTRINSIC
low complexity region	426	447	N/A	INTRINSIC
low complexity region	465	484	N/A	INTRINSIC
coiled coil region	568	610	N/A	INTRINSIC
Pfam:CCDC66	661	810	2e-11	PFAM
coiled coil region	866	903	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153804

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186294
AA Change: Q368R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763
AA Change: Q368R

Domain	Start	End	E-Value	Type
low complexity region	266	281	N/A	INTRINSIC
coiled coil region	345	379	N/A	INTRINSIC
low complexity region	422	443	N/A	INTRINSIC
low complexity region	461	480	N/A	INTRINSIC
SCOP:d1eq1a_	567	748	4e-3	SMART
coiled coil region	811	848	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188249

Predicted Effect

unknown
Transcript: ENSMUST00000188449
AA Change: Q60R

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417H12Rik	T	C	7: 107,624,690		probably benign	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Adgrf2	T	C	17: 42,711,193	I247V	probably benign	Het
Adgrv1	A	G	13: 81,270,738		probably null	Het
Ankrd22	T	A	19: 34,149,352	K26I	possibly damaging	Het
Arhgap32	T	A	9: 32,245,256		probably null	Het
Armc10	A	G	5: 21,661,524	Y262C	probably damaging	Het
Arrb2	A	G	11: 70,439,899	D374G	probably benign	Het
Ascc3	C	T	10: 50,749,131	R1675C	probably damaging	Het
Atg5	T	C	10: 44,363,050	*276R	probably null	Het
Bcl11b	G	A	12: 107,916,709	T377M	probably damaging	Het
C1s2	C	A	6: 124,635,114	E104*	probably null	Het
Carf	A	T	1: 60,141,367	H316L	probably damaging	Het
Ccdc77	A	T	6: 120,334,835	I234N	probably damaging	Het
Cd300c2	A	T	11: 114,997,000	V192E	possibly damaging	Het
Cep72	G	A	13: 74,059,465	R62C	probably damaging	Het
Clasp1	T	A	1: 118,508,910	L308*	probably null	Het
Clec2g	A	G	6: 128,979,448	S25G	probably benign	Het
Cngb1	T	C	8: 95,251,973	M1046V	probably damaging	Het
Cobll1	A	T	2: 65,097,693	D1095E	probably benign	Het
Cpeb2	A	G	5: 43,244,662	H662R	possibly damaging	Het
Cps1	A	T	1: 67,139,763	T45S	probably benign	Het
Dcaf6	C	A	1: 165,411,463		probably null	Het
Dcst1	T	C	3: 89,350,507	Y652C	possibly damaging	Het
Elf5	T	G	2: 103,449,573	Y225*	probably null	Het
Ermap	A	C	4: 119,188,818		probably benign	Het
Fam186b	A	T	15: 99,271,321	V915D	probably damaging	Het
Fbxo34	C	A	14: 47,529,454	N90K	probably benign	Het
Flnc	A	G	6: 29,447,525	E1109G	probably damaging	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Gabpb2	A	G	3: 95,190,636	V242A	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gm14409	T	C	2: 177,265,430	T92A	possibly damaging	Het
Gm21798	A	T	15: 64,817,883		probably benign	Het
Gm765	A	T	6: 98,238,119	M181K	probably damaging	Het
Gpr179	A	T	11: 97,346,661	S345T	possibly damaging	Het
Gusb	A	T	5: 129,998,118	F377L	probably damaging	Het
Hnrnpu	T	C	1: 178,329,373		probably benign	Het
Htr3b	C	T	9: 48,937,048		probably null	Het
Iqub	A	T	6: 24,501,369	V194D	probably damaging	Het
Itga2b	A	G	11: 102,461,159	V504A	probably benign	Het
Itga4	T	A	2: 79,288,248	F430L	probably damaging	Het
Jcad	C	A	18: 4,673,762	P508H	probably damaging	Het
Jph1	T	C	1: 17,091,611	T276A	probably damaging	Het
Kansl2	A	G	15: 98,531,890	F87S	possibly damaging	Het
Kdm1b	T	C	13: 47,063,144		probably null	Het
Kif5b	C	T	18: 6,220,930	D393N	probably benign	Het
Kmt2d	A	T	15: 98,849,539		probably benign	Het
Krt75	A	G	15: 101,570,239	I320T	probably damaging	Het
Lipo5	T	C	19: 33,465,948	N156S	unknown	Het
Mblac2	A	C	13: 81,711,587	Q19P	probably null	Het
Mfsd4b3	T	C	10: 39,948,060	H68R	probably damaging	Het
Mzb1	A	T	18: 35,647,953		probably null	Het
Nup210l	T	A	3: 90,170,030	I891N	probably benign	Het
Nwd1	G	A	8: 72,672,213	R667Q	probably damaging	Het
Oas1h	C	T	5: 120,867,109	Q207*	probably null	Het
Olfr159	A	T	4: 43,770,476	F178L	possibly damaging	Het
Pcdh15	C	T	10: 74,504,793	R1120*	probably null	Het
Pfkl	A	G	10: 77,988,310	L748P	probably damaging	Het
Phldb2	T	A	16: 45,751,395	K473N	probably damaging	Het
Rapgef6	G	A	11: 54,552,836	V82I	probably damaging	Het
Rfc3	A	T	5: 151,647,495	L112Q	probably damaging	Het
Rsph6a	T	A	7: 19,068,072	C349S	possibly damaging	Het
Sec16a	A	T	2: 26,441,967		probably benign	Het
Sept14	T	A	5: 129,692,966	Y222F	probably benign	Het
Skor2	T	C	18: 76,860,295	S571P	possibly damaging	Het
Slc13a5	T	A	11: 72,257,418	M264L	probably damaging	Het
Slc45a3	T	A	1: 131,981,577	V504E	probably damaging	Het
Smg1	C	T	7: 118,152,408		probably benign	Het
Smim20	A	G	5: 53,277,161	N45S	probably null	Het
Spp2	A	T	1: 88,412,269	S111C	probably damaging	Het
Sspo	A	G	6: 48,465,730		probably null	Het
Sycp2	C	T	2: 178,403,657		probably null	Het
Tas2r113	A	G	6: 132,893,558	N183S	possibly damaging	Het
Tcaf2	A	T	6: 42,629,745	M425K	probably benign	Het
Tdrp	A	G	8: 13,953,845	V164A	possibly damaging	Het
Tmbim1	A	G	1: 74,289,409	F298S	probably damaging	Het
Tmem211	T	A	5: 113,238,170	M161K	probably benign	Het
Tmem89	A	G	9: 108,914,761		probably benign	Het
Trpm2	G	T	10: 77,932,189	C825*	probably null	Het
Tsc1	A	G	2: 28,675,189	E421G	possibly damaging	Het
Usp24	T	C	4: 106,388,637	I1364T	probably benign	Het
Vmn1r52	G	A	6: 90,178,948	G78E	possibly damaging	Het
Vmn2r73	T	G	7: 85,857,621	I828L	probably damaging	Het
Vwa5b1	A	T	4: 138,610,747	D87E	probably benign	Het
Zfp451	A	T	1: 33,805,384	D47E	probably damaging	Het
Zfp821	A	G	8: 109,724,209	E278G	probably damaging	Het
Zfp930	A	T	8: 69,228,945	T430S	probably benign	Het
Zfp994	G	T	17: 22,200,467	Y500*	probably null	Het
Zmat3	A	T	3: 32,343,687	I142N	probably damaging	Het
Zzef1	T	A	11: 72,901,388	I2266N	probably damaging	Het

Other mutations in Cspp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Cspp1	APN	1	10112551	unclassified	probably benign
IGL01070:Cspp1	APN	1	10088145	missense	probably damaging	0.99
IGL01384:Cspp1	APN	1	10116680	missense	probably damaging	1.00
IGL01400:Cspp1	APN	1	10085931	missense	probably damaging	0.99
IGL01893:Cspp1	APN	1	10134141	splice site	probably null
IGL01909:Cspp1	APN	1	10066661	missense	probably benign	0.01
IGL02229:Cspp1	APN	1	10083556	missense	probably damaging	1.00
IGL02397:Cspp1	APN	1	10108465	missense	possibly damaging	0.66
IGL02983:Cspp1	APN	1	10127525	missense	probably benign	0.34
IGL03352:Cspp1	APN	1	10047437	missense	possibly damaging	0.93
PIT4453001:Cspp1	UTSW	1	10074872	missense	possibly damaging	0.83
R0312:Cspp1	UTSW	1	10058829	splice site	probably benign
R0782:Cspp1	UTSW	1	10129974	splice site	probably benign
R0931:Cspp1	UTSW	1	10104286	missense	probably damaging	0.98
R1499:Cspp1	UTSW	1	10088966	splice site	probably null
R1553:Cspp1	UTSW	1	10085897	missense	possibly damaging	0.94
R1613:Cspp1	UTSW	1	10133241	missense	probably damaging	1.00
R1644:Cspp1	UTSW	1	10126438	missense	probably damaging	0.99
R2042:Cspp1	UTSW	1	10112538	missense	probably damaging	0.98
R2090:Cspp1	UTSW	1	10090268	missense	possibly damaging	0.89
R2178:Cspp1	UTSW	1	10104246	missense	possibly damaging	0.81
R2247:Cspp1	UTSW	1	10066460	missense	possibly damaging	0.87
R2680:Cspp1	UTSW	1	10104305	missense	probably damaging	1.00
R3803:Cspp1	UTSW	1	10126373	missense	probably damaging	1.00
R4520:Cspp1	UTSW	1	10134227	missense	probably benign	0.11
R4531:Cspp1	UTSW	1	10066847	intron	probably benign
R4960:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R4973:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R4976:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R4978:Cspp1	UTSW	1	10083517	missense	possibly damaging	0.66
R4979:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R4981:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R4983:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R5032:Cspp1	UTSW	1	10066519	missense	probably benign	0.07
R5057:Cspp1	UTSW	1	10074961	splice site	probably benign
R5081:Cspp1	UTSW	1	10047466	missense	possibly damaging	0.57
R5119:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R5121:Cspp1	UTSW	1	10126463	missense	probably damaging	1.00
R5146:Cspp1	UTSW	1	10074876	nonsense	probably null
R5373:Cspp1	UTSW	1	10134126	missense	probably damaging	1.00
R5374:Cspp1	UTSW	1	10134126	missense	probably damaging	1.00
R6230:Cspp1	UTSW	1	10077197	missense	probably benign	0.01
R6291:Cspp1	UTSW	1	10064334	missense	probably damaging	0.97
R6382:Cspp1	UTSW	1	10083475	splice site	probably null
R7135:Cspp1	UTSW	1	10088936	missense	possibly damaging	0.92
R7388:Cspp1	UTSW	1	10065347	nonsense	probably null
R7647:Cspp1	UTSW	1	10135937	missense	probably benign	0.26
R7722:Cspp1	UTSW	1	10074901	missense	probably benign	0.00
R8039:Cspp1	UTSW	1	10113013	missense	probably benign	0.02
R8087:Cspp1	UTSW	1	10104264	missense	possibly damaging	0.81
R8339:Cspp1	UTSW	1	10113667	missense	probably damaging	1.00
R8719:Cspp1	UTSW	1	10090291	missense	possibly damaging	0.83
R8774:Cspp1	UTSW	1	10112914	missense	possibly damaging	0.46
R8774-TAIL:Cspp1	UTSW	1	10112914	missense	possibly damaging	0.46
R8979:Cspp1	UTSW	1	10064405	missense	probably benign	0.27
R9068:Cspp1	UTSW	1	10077244	critical splice donor site	probably null
R9071:Cspp1	UTSW	1	10088896	missense	possibly damaging	0.66
R9080:Cspp1	UTSW	1	10113694	missense	probably benign	0.25
Z1088:Cspp1	UTSW	1	10083546	missense	possibly damaging	0.81
Z1177:Cspp1	UTSW	1	10095878	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGTGACTTTCCTCATAACTATAG -3'
(R):5'- GGGTCGACTACAATGGAGTAC -3'

Sequencing Primer
(F):5'- GGCTGGTCTCGAACTCAGAAATC -3'
(R):5'- TCGACTACAATGGAGTACTGTGATG -3'

Posted On

2016-04-15