Incidental Mutation 'R4906:Cspp1'
ID378146
Institutional Source Beutler Lab
Gene Symbol Cspp1
Ensembl Gene ENSMUSG00000056763
Gene Namecentrosome and spindle pole associated protein 1
Synonyms2310020J12Rik, 4930413O22Rik
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location10037987-10136768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10082328 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 368 (Q368R)
Ref Sequence ENSEMBL: ENSMUSP00000139775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000186294]
Predicted Effect probably benign
Transcript: ENSMUST00000071087
AA Change: Q372R

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763
AA Change: Q372R

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
coiled coil region 349 383 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 465 484 N/A INTRINSIC
coiled coil region 568 610 N/A INTRINSIC
Pfam:CCDC66 661 810 2e-11 PFAM
coiled coil region 866 903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153804
Predicted Effect possibly damaging
Transcript: ENSMUST00000186294
AA Change: Q368R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763
AA Change: Q368R

DomainStartEndE-ValueType
low complexity region 266 281 N/A INTRINSIC
coiled coil region 345 379 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 461 480 N/A INTRINSIC
SCOP:d1eq1a_ 567 748 4e-3 SMART
coiled coil region 811 848 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188249
Predicted Effect unknown
Transcript: ENSMUST00000188449
AA Change: Q60R
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Cspp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cspp1 APN 1 10112551 unclassified probably benign
IGL01070:Cspp1 APN 1 10088145 missense probably damaging 0.99
IGL01384:Cspp1 APN 1 10116680 missense probably damaging 1.00
IGL01400:Cspp1 APN 1 10085931 missense probably damaging 0.99
IGL01893:Cspp1 APN 1 10134141 splice site probably null
IGL01909:Cspp1 APN 1 10066661 missense probably benign 0.01
IGL02229:Cspp1 APN 1 10083556 missense probably damaging 1.00
IGL02397:Cspp1 APN 1 10108465 missense possibly damaging 0.66
IGL02983:Cspp1 APN 1 10127525 missense probably benign 0.34
IGL03352:Cspp1 APN 1 10047437 missense possibly damaging 0.93
PIT4453001:Cspp1 UTSW 1 10074872 missense possibly damaging 0.83
R0312:Cspp1 UTSW 1 10058829 splice site probably benign
R0782:Cspp1 UTSW 1 10129974 splice site probably benign
R0931:Cspp1 UTSW 1 10104286 missense probably damaging 0.98
R1499:Cspp1 UTSW 1 10088966 splice site probably null
R1553:Cspp1 UTSW 1 10085897 missense possibly damaging 0.94
R1613:Cspp1 UTSW 1 10133241 missense probably damaging 1.00
R1644:Cspp1 UTSW 1 10126438 missense probably damaging 0.99
R2042:Cspp1 UTSW 1 10112538 missense probably damaging 0.98
R2090:Cspp1 UTSW 1 10090268 missense possibly damaging 0.89
R2178:Cspp1 UTSW 1 10104246 missense possibly damaging 0.81
R2247:Cspp1 UTSW 1 10066460 missense possibly damaging 0.87
R2680:Cspp1 UTSW 1 10104305 missense probably damaging 1.00
R3803:Cspp1 UTSW 1 10126373 missense probably damaging 1.00
R4520:Cspp1 UTSW 1 10134227 missense probably benign 0.11
R4531:Cspp1 UTSW 1 10066847 intron probably benign
R4960:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4973:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4976:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4978:Cspp1 UTSW 1 10083517 missense possibly damaging 0.66
R4979:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4981:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4983:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5032:Cspp1 UTSW 1 10066519 missense probably benign 0.07
R5057:Cspp1 UTSW 1 10074961 splice site probably benign
R5081:Cspp1 UTSW 1 10047466 missense possibly damaging 0.57
R5119:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5121:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5146:Cspp1 UTSW 1 10074876 nonsense probably null
R5373:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R5374:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R6230:Cspp1 UTSW 1 10077197 missense probably benign 0.01
R6291:Cspp1 UTSW 1 10064334 missense probably damaging 0.97
R6382:Cspp1 UTSW 1 10083475 splice site probably null
R7135:Cspp1 UTSW 1 10088936 missense possibly damaging 0.92
R7388:Cspp1 UTSW 1 10065347 nonsense probably null
R7647:Cspp1 UTSW 1 10135937 missense probably benign 0.26
R7722:Cspp1 UTSW 1 10074901 missense probably benign 0.00
R8039:Cspp1 UTSW 1 10113013 missense probably benign 0.02
R8087:Cspp1 UTSW 1 10104264 missense possibly damaging 0.81
R8339:Cspp1 UTSW 1 10113667 missense probably damaging 1.00
Z1088:Cspp1 UTSW 1 10083546 missense possibly damaging 0.81
Z1177:Cspp1 UTSW 1 10095878 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTGTGACTTTCCTCATAACTATAG -3'
(R):5'- GGGTCGACTACAATGGAGTAC -3'

Sequencing Primer
(F):5'- GGCTGGTCTCGAACTCAGAAATC -3'
(R):5'- TCGACTACAATGGAGTACTGTGATG -3'
Posted On2016-04-15