Incidental Mutation 'R4906:Cps1'
ID378151
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67139763 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 45 (T45S)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably benign
Transcript: ENSMUST00000027144
AA Change: T45S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: T45S

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R8097:Cps1 UTSW 1 67228270 missense probably benign 0.08
R8357:Cps1 UTSW 1 67156854 missense probably damaging 1.00
R8435:Cps1 UTSW 1 67212430 missense probably benign 0.07
R8457:Cps1 UTSW 1 67156854 missense probably damaging 1.00
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTTGGAGAACACTTGCAGG -3'
(R):5'- TGCACAAAGCTCCACATGAG -3'

Sequencing Primer
(F):5'- CTTGGAGAACACTTGCAGGTAACAC -3'
(R):5'- TGCAATGATGTGATTTCAACCTG -3'
Posted On2016-04-15