Incidental Mutation 'R4906:Clasp1'
ID378155
Institutional Source Beutler Lab
Gene Symbol Clasp1
Ensembl Gene ENSMUSG00000064302
Gene NameCLIP associating protein 1
Synonyms1700030C23Rik, B130045P17Rik, CLASP1, mCLASP1, 5730583A19Rik, CLASP1alpha
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location118389058-118612678 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 118508910 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 308 (L308*)
Ref Sequence ENSEMBL: ENSMUSP00000142203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049404] [ENSMUST00000070989] [ENSMUST00000165223] [ENSMUST00000178710] [ENSMUST00000185405] [ENSMUST00000186349] [ENSMUST00000187713] [ENSMUST00000188710] [ENSMUST00000189262] [ENSMUST00000189570] [ENSMUST00000189738] [ENSMUST00000190571] [ENSMUST00000191445] [ENSMUST00000191823] [ENSMUST00000190733]
Predicted Effect probably null
Transcript: ENSMUST00000049404
AA Change: L540*
SMART Domains Protein: ENSMUSP00000042266
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000070989
AA Change: L540*
SMART Domains Protein: ENSMUSP00000067858
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 3.23e-1 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 4.96e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165223
AA Change: L540*
SMART Domains Protein: ENSMUSP00000128089
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1056 3.23e-1 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 4.96e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178710
AA Change: L540*
SMART Domains Protein: ENSMUSP00000137137
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1047 6.55e-2 SMART
low complexity region 1058 1075 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
TOG 1210 1448 4.96e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185405
AA Change: L540*
SMART Domains Protein: ENSMUSP00000139619
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 769 783 N/A INTRINSIC
low complexity region 801 811 N/A INTRINSIC
TOG 827 1065 1.6e-5 SMART
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1166 1177 N/A INTRINSIC
TOG 1228 1466 2.3e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186349
AA Change: L540*
SMART Domains Protein: ENSMUSP00000141105
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187713
AA Change: L540*
SMART Domains Protein: ENSMUSP00000139526
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 768 782 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
TOG 826 1064 1.6e-5 SMART
low complexity region 1075 1092 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
TOG 1227 1465 2.3e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188710
AA Change: L540*
SMART Domains Protein: ENSMUSP00000140593
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 818 832 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 1.6e-5 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 2.3e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189216
Predicted Effect probably null
Transcript: ENSMUST00000189262
AA Change: L540*
SMART Domains Protein: ENSMUSP00000140860
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
TOG 802 1040 1.6e-5 SMART
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
TOG 1203 1441 2.3e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189570
AA Change: L540*
SMART Domains Protein: ENSMUSP00000140167
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1055 3.2e-6 SMART
low complexity region 1066 1083 N/A INTRINSIC
low complexity region 1156 1167 N/A INTRINSIC
TOG 1218 1456 2.3e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189738
AA Change: L540*
SMART Domains Protein: ENSMUSP00000140665
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1048 3.23e-1 SMART
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
TOG 1211 1449 4.96e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190571
AA Change: L540*
SMART Domains Protein: ENSMUSP00000140019
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
low complexity region 805 819 N/A INTRINSIC
low complexity region 837 847 N/A INTRINSIC
TOG 863 1101 1.6e-5 SMART
low complexity region 1112 1129 N/A INTRINSIC
low complexity region 1150 1163 N/A INTRINSIC
low complexity region 1241 1252 N/A INTRINSIC
TOG 1303 1541 2.3e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191445
AA Change: L540*
SMART Domains Protein: ENSMUSP00000140095
Gene: ENSMUSG00000064302
AA Change: L540*

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 761 775 N/A INTRINSIC
low complexity region 793 803 N/A INTRINSIC
TOG 819 1056 3.2e-6 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 2.3e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191823
AA Change: L308*
SMART Domains Protein: ENSMUSP00000142203
Gene: ENSMUSG00000064302
AA Change: L308*

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
TOG 87 319 5.6e-16 SMART
low complexity region 347 362 N/A INTRINSIC
low complexity region 374 401 N/A INTRINSIC
low complexity region 450 483 N/A INTRINSIC
low complexity region 537 551 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
TOG 594 832 1.6e-5 SMART
low complexity region 843 860 N/A INTRINSIC
low complexity region 933 944 N/A INTRINSIC
TOG 995 1233 2.4e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205176
Predicted Effect probably benign
Transcript: ENSMUST00000204904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203646
Predicted Effect probably benign
Transcript: ENSMUST00000190733
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Clasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01786:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01871:Clasp1 APN 1 118570889 missense probably damaging 1.00
IGL02066:Clasp1 APN 1 118565260 critical splice donor site probably null
IGL02602:Clasp1 APN 1 118471785 missense probably damaging 0.99
IGL02683:Clasp1 APN 1 118539266 missense probably benign 0.33
IGL02728:Clasp1 APN 1 118602377 missense probably damaging 1.00
IGL02820:Clasp1 APN 1 118551104 missense possibly damaging 0.77
IGL02874:Clasp1 APN 1 118552043 missense possibly damaging 0.86
IGL02975:Clasp1 APN 1 118462547 missense probably damaging 1.00
IGL03100:Clasp1 APN 1 118467896 missense possibly damaging 0.79
IGL03115:Clasp1 APN 1 118501323 nonsense probably null
IGL03122:Clasp1 APN 1 118510277 missense probably damaging 1.00
IGL03180:Clasp1 APN 1 118505525 missense probably benign 0.33
IGL03248:Clasp1 APN 1 118602476 missense probably benign 0.01
IGL03388:Clasp1 APN 1 118505503 missense possibly damaging 0.95
F5770:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
I2288:Clasp1 UTSW 1 118565229 missense probably benign 0.09
PIT4585001:Clasp1 UTSW 1 118462555 missense probably damaging 0.99
R0079:Clasp1 UTSW 1 118543304 missense probably damaging 1.00
R0395:Clasp1 UTSW 1 118539331 missense possibly damaging 0.48
R0960:Clasp1 UTSW 1 118552026 missense probably benign 0.39
R1448:Clasp1 UTSW 1 118508916 missense probably benign 0.01
R1497:Clasp1 UTSW 1 118552058 missense probably benign 0.42
R1607:Clasp1 UTSW 1 118504959 missense probably damaging 0.98
R1722:Clasp1 UTSW 1 118590464 missense probably damaging 1.00
R1758:Clasp1 UTSW 1 118548025 missense probably damaging 1.00
R1765:Clasp1 UTSW 1 118505531 missense probably damaging 0.99
R1855:Clasp1 UTSW 1 118508894 missense probably damaging 1.00
R1861:Clasp1 UTSW 1 118570931 missense possibly damaging 0.93
R1874:Clasp1 UTSW 1 118600585 critical splice donor site probably null
R1942:Clasp1 UTSW 1 118501348 missense possibly damaging 0.94
R2025:Clasp1 UTSW 1 118504899 missense probably damaging 1.00
R2174:Clasp1 UTSW 1 118560095 missense probably damaging 1.00
R2280:Clasp1 UTSW 1 118565183 missense probably benign 0.05
R2288:Clasp1 UTSW 1 118578878 missense probably benign
R2895:Clasp1 UTSW 1 118459838 missense probably damaging 1.00
R3958:Clasp1 UTSW 1 118467881 missense probably damaging 0.99
R4073:Clasp1 UTSW 1 118503848 missense probably damaging 1.00
R4206:Clasp1 UTSW 1 118578906 missense probably damaging 1.00
R4465:Clasp1 UTSW 1 118561078 missense probably damaging 1.00
R4609:Clasp1 UTSW 1 118503035 intron probably benign
R4679:Clasp1 UTSW 1 118543271 missense probably damaging 0.99
R4707:Clasp1 UTSW 1 118543197 nonsense probably null
R4809:Clasp1 UTSW 1 118461250 missense probably benign 0.00
R5048:Clasp1 UTSW 1 118547610 intron probably benign
R5298:Clasp1 UTSW 1 118547920 missense possibly damaging 0.71
R5485:Clasp1 UTSW 1 118467913 missense possibly damaging 0.95
R5516:Clasp1 UTSW 1 118497721 missense probably damaging 1.00
R5821:Clasp1 UTSW 1 118590484 missense probably damaging 1.00
R5911:Clasp1 UTSW 1 118506908 unclassified probably benign
R6092:Clasp1 UTSW 1 118510298 missense probably damaging 0.97
R6181:Clasp1 UTSW 1 118419817 missense probably benign 0.18
R6478:Clasp1 UTSW 1 118512180 nonsense probably null
R7090:Clasp1 UTSW 1 118482086 missense probably benign 0.45
R7216:Clasp1 UTSW 1 118547918 missense probably benign 0.00
R7508:Clasp1 UTSW 1 118545434 missense probably benign 0.30
R7541:Clasp1 UTSW 1 118542997 splice site probably null
R7644:Clasp1 UTSW 1 118512750 splice site probably null
R7825:Clasp1 UTSW 1 118545393 missense probably benign 0.00
R7910:Clasp1 UTSW 1 118602414 nonsense probably null
R7971:Clasp1 UTSW 1 118521829 missense probably damaging 0.99
R8074:Clasp1 UTSW 1 118462483 missense probably benign
R8344:Clasp1 UTSW 1 118503899 missense probably damaging 1.00
V7581:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
X0028:Clasp1 UTSW 1 118551125 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTCAAAGATGCTGTGTGGCG -3'
(R):5'- ACCTCCTGAGTGAGCAGTATCC -3'

Sequencing Primer
(F):5'- CAAAGATGCTGTGTGGCGTACTG -3'
(R):5'- AGACTATACCTTGACCTCTGGGGAG -3'
Posted On2016-04-15