Incidental Mutation 'R4906:Zmat3'
ID378167
Institutional Source Beutler Lab
Gene Symbol Zmat3
Ensembl Gene ENSMUSG00000027663
Gene Namezinc finger matrin type 3
SynonymsWig1
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32334792-32366014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32343687 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 142 (I142N)
Ref Sequence ENSEMBL: ENSMUSP00000131317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029199] [ENSMUST00000168566]
Predicted Effect probably damaging
Transcript: ENSMUST00000029199
AA Change: I142N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029199
Gene: ENSMUSG00000027663
AA Change: I142N

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168566
AA Change: I142N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131317
Gene: ENSMUSG00000027663
AA Change: I142N

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Zmat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Zmat3 APN 3 32341678 missense possibly damaging 0.82
IGL01687:Zmat3 APN 3 32341531 missense probably damaging 1.00
IGL02251:Zmat3 APN 3 32345583 splice site probably benign
IGL03110:Zmat3 APN 3 32345552 missense probably damaging 0.98
R0585:Zmat3 UTSW 3 32361105 missense probably damaging 0.96
R1258:Zmat3 UTSW 3 32343671 missense probably damaging 0.99
R1916:Zmat3 UTSW 3 32343348 missense probably benign 0.00
R1968:Zmat3 UTSW 3 32360982 missense probably damaging 1.00
R4805:Zmat3 UTSW 3 32343355 missense probably benign 0.00
R6252:Zmat3 UTSW 3 32341621 missense possibly damaging 0.55
R6844:Zmat3 UTSW 3 32341495 missense probably damaging 1.00
R7998:Zmat3 UTSW 3 32341666 missense possibly damaging 0.89
R8316:Zmat3 UTSW 3 32341521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAGTGAGCCAGTCGAAC -3'
(R):5'- CAGTCTCTCTTTGCGGGGATTTAC -3'

Sequencing Primer
(F):5'- GTCGAACAAGGCTCCCTTTCAG -3'
(R):5'- TCAAGGCTCTGAAGGATC -3'
Posted On2016-04-15