Incidental Mutation 'R4906:Usp24'
ID378172
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Nameubiquitin specific peptidase 24
Synonyms2810030C21Rik, 2700066K03Rik
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106316213-106441322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106388637 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1364 (I1364T)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
Predicted Effect probably benign
Transcript: ENSMUST00000094933
AA Change: I1363T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: I1363T

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165709
AA Change: I1364T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: I1364T

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 splice site probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 splice site probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 splice site probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R7940:Usp24 UTSW 4 106430544 missense probably damaging 0.98
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
R8348:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCCAGCATGTCTTTCTCACAATAC -3'
(R):5'- CTTACAGCTAATTCTTGCCCAATG -3'

Sequencing Primer
(F):5'- AATACCCTTTCCATGCCTCCTTAGAC -3'
(R):5'- GCTATGGAGATTTTTCTACATGGAC -3'
Posted On2016-04-15