Incidental Mutation 'R4906:Oas1h'
ID 378180
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 042508-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4906 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 121005172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 207 (Q207*)
Ref Sequence ENSEMBL: ENSMUSP00000132033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably null
Transcript: ENSMUST00000072476
AA Change: Q207*
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: Q207*

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171820
AA Change: Q207*
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168
AA Change: Q207*

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,223,897 (GRCm39) probably benign Het
Ablim2 C T 5: 35,959,766 (GRCm39) R73C possibly damaging Het
Adgrf2 T C 17: 43,022,084 (GRCm39) I247V probably benign Het
Adgrv1 A G 13: 81,418,857 (GRCm39) probably null Het
Ankrd22 T A 19: 34,126,752 (GRCm39) K26I possibly damaging Het
Arhgap32 T A 9: 32,156,552 (GRCm39) probably null Het
Armc10 A G 5: 21,866,522 (GRCm39) Y262C probably damaging Het
Arrb2 A G 11: 70,330,725 (GRCm39) D374G probably benign Het
Ascc3 C T 10: 50,625,227 (GRCm39) R1675C probably damaging Het
Atg5 T C 10: 44,239,046 (GRCm39) *276R probably null Het
Bcl11b G A 12: 107,882,968 (GRCm39) T377M probably damaging Het
C1s2 C A 6: 124,612,073 (GRCm39) E104* probably null Het
Carf A T 1: 60,180,526 (GRCm39) H316L probably damaging Het
Ccdc77 A T 6: 120,311,796 (GRCm39) I234N probably damaging Het
Cd300c2 A T 11: 114,887,826 (GRCm39) V192E possibly damaging Het
Cep72 G A 13: 74,207,584 (GRCm39) R62C probably damaging Het
Clasp1 T A 1: 118,436,640 (GRCm39) L308* probably null Het
Clec2g A G 6: 128,956,411 (GRCm39) S25G probably benign Het
Cngb1 T C 8: 95,978,601 (GRCm39) M1046V probably damaging Het
Cobll1 A T 2: 64,928,037 (GRCm39) D1095E probably benign Het
Cpeb2 A G 5: 43,402,005 (GRCm39) H662R possibly damaging Het
Cps1 A T 1: 67,178,922 (GRCm39) T45S probably benign Het
Cspp1 A G 1: 10,152,553 (GRCm39) Q368R possibly damaging Het
Dcaf6 C A 1: 165,239,032 (GRCm39) probably null Het
Dcst1 T C 3: 89,257,814 (GRCm39) Y652C possibly damaging Het
Elf5 T G 2: 103,279,918 (GRCm39) Y225* probably null Het
Ermap A C 4: 119,046,015 (GRCm39) probably benign Het
Fam186b A T 15: 99,169,202 (GRCm39) V915D probably damaging Het
Fbxo34 C A 14: 47,766,911 (GRCm39) N90K probably benign Het
Flnc A G 6: 29,447,524 (GRCm39) E1109G probably damaging Het
Flt1 C A 5: 147,620,749 (GRCm39) A132S probably benign Het
Gabpb2 A G 3: 95,097,947 (GRCm39) V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gm21798 A T 15: 64,689,732 (GRCm39) probably benign Het
Gpr179 A T 11: 97,237,487 (GRCm39) S345T possibly damaging Het
Gusb A T 5: 130,026,959 (GRCm39) F377L probably damaging Het
Hnrnpu T C 1: 178,156,938 (GRCm39) probably benign Het
Htr3b C T 9: 48,848,348 (GRCm39) probably null Het
Iqub A T 6: 24,501,368 (GRCm39) V194D probably damaging Het
Itga2b A G 11: 102,351,985 (GRCm39) V504A probably benign Het
Itga4 T A 2: 79,118,592 (GRCm39) F430L probably damaging Het
Jcad C A 18: 4,673,762 (GRCm39) P508H probably damaging Het
Jph1 T C 1: 17,161,835 (GRCm39) T276A probably damaging Het
Kansl2 A G 15: 98,429,771 (GRCm39) F87S possibly damaging Het
Kdm1b T C 13: 47,216,620 (GRCm39) probably null Het
Kif5b C T 18: 6,220,930 (GRCm39) D393N probably benign Het
Kmt2d A T 15: 98,747,420 (GRCm39) probably benign Het
Krt75 A G 15: 101,478,674 (GRCm39) I320T probably damaging Het
Lhfpl7 T A 5: 113,386,036 (GRCm39) M161K probably benign Het
Lipo5 T C 19: 33,443,348 (GRCm39) N156S unknown Het
Mblac2 A C 13: 81,859,706 (GRCm39) Q19P probably null Het
Mdfic2 A T 6: 98,215,080 (GRCm39) M181K probably damaging Het
Mfsd4b3-ps T C 10: 39,824,056 (GRCm39) H68R probably damaging Het
Mzb1 A T 18: 35,781,006 (GRCm39) probably null Het
Nup210l T A 3: 90,077,337 (GRCm39) I891N probably benign Het
Nwd1 G A 8: 73,398,841 (GRCm39) R667Q probably damaging Het
Or13c7d A T 4: 43,770,476 (GRCm39) F178L possibly damaging Het
Pcdh15 C T 10: 74,340,625 (GRCm39) R1120* probably null Het
Pfkl A G 10: 77,824,144 (GRCm39) L748P probably damaging Het
Phldb2 T A 16: 45,571,758 (GRCm39) K473N probably damaging Het
Rapgef6 G A 11: 54,443,662 (GRCm39) V82I probably damaging Het
Rfc3 A T 5: 151,570,960 (GRCm39) L112Q probably damaging Het
Rsph6a T A 7: 18,801,997 (GRCm39) C349S possibly damaging Het
Sec16a A T 2: 26,331,979 (GRCm39) probably benign Het
Septin14 T A 5: 129,770,030 (GRCm39) Y222F probably benign Het
Skor2 T C 18: 76,947,990 (GRCm39) S571P possibly damaging Het
Slc13a5 T A 11: 72,148,244 (GRCm39) M264L probably damaging Het
Slc45a3 T A 1: 131,909,315 (GRCm39) V504E probably damaging Het
Smg1 C T 7: 117,751,631 (GRCm39) probably benign Het
Smim20 A G 5: 53,434,503 (GRCm39) N45S probably null Het
Spp2 A T 1: 88,339,991 (GRCm39) S111C probably damaging Het
Sspo A G 6: 48,442,664 (GRCm39) probably null Het
Sycp2 C T 2: 178,045,450 (GRCm39) probably null Het
Tas2r113 A G 6: 132,870,521 (GRCm39) N183S possibly damaging Het
Tcaf2 A T 6: 42,606,679 (GRCm39) M425K probably benign Het
Tdrp A G 8: 14,003,845 (GRCm39) V164A possibly damaging Het
Tmbim1 A G 1: 74,328,568 (GRCm39) F298S probably damaging Het
Tmem89 A G 9: 108,743,829 (GRCm39) probably benign Het
Trpm2 G T 10: 77,768,023 (GRCm39) C825* probably null Het
Tsc1 A G 2: 28,565,201 (GRCm39) E421G possibly damaging Het
Usp24 T C 4: 106,245,834 (GRCm39) I1364T probably benign Het
Vmn1r52 G A 6: 90,155,930 (GRCm39) G78E possibly damaging Het
Vmn2r73 T G 7: 85,506,829 (GRCm39) I828L probably damaging Het
Vwa5b1 A T 4: 138,338,058 (GRCm39) D87E probably benign Het
Zfp1010 T C 2: 176,957,223 (GRCm39) T92A possibly damaging Het
Zfp451 A T 1: 33,844,465 (GRCm39) D47E probably damaging Het
Zfp821 A G 8: 110,450,841 (GRCm39) E278G probably damaging Het
Zfp930 A T 8: 69,681,597 (GRCm39) T430S probably benign Het
Zfp994 G T 17: 22,419,448 (GRCm39) Y500* probably null Het
Zmat3 A T 3: 32,397,836 (GRCm39) I142N probably damaging Het
Zzef1 T A 11: 72,792,214 (GRCm39) I2266N probably damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4814:Oas1h UTSW 5 121,000,728 (GRCm39) missense probably damaging 0.99
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5160:Oas1h UTSW 5 121,009,145 (GRCm39) missense probably damaging 1.00
R5698:Oas1h UTSW 5 121,009,045 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7966:Oas1h UTSW 5 121,009,962 (GRCm39) missense probably damaging 0.97
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8951:Oas1h UTSW 5 121,000,657 (GRCm39) missense probably damaging 1.00
R8987:Oas1h UTSW 5 121,005,152 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCACAGAGCAGGGATGAGTC -3'
(R):5'- AGCATCAATTTGTAAGTGGGCC -3'

Sequencing Primer
(F):5'- CCACAGAGCAGGGATGAGTCTAAAC -3'
(R):5'- TGAGCAGAATTCCTCCATGG -3'
Posted On 2016-04-15