Mutagenetix > Incidental Mutations

Incidental Mutation 'R4906:Flnc'

378186

Institutional Source

Beutler Lab

Gene Symbol

Flnc

Ensembl Gene

ENSMUSG00000068699

Gene Name

filamin C, gamma

Synonyms

1110055E19Rik, actin binding protein 280, Fln2

MMRRC Submission

042508-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4906 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29433256-29461883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29447525 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1109 (E1109G)

Ref Sequence

ENSEMBL: ENSMUSP00000099139 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065090
AA Change: E1109G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699
AA Change: E1109G

Domain	Start	End	E-Value	Type
CH	39	141	1.17e-25	SMART
CH	162	258	2.09e-22	SMART
IG_FLMN	275	372	3.84e-38	SMART
IG_FLMN	375	472	3.73e-36	SMART
IG_FLMN	474	569	4.41e-38	SMART
IG_FLMN	571	662	3.61e-34	SMART
IG_FLMN	667	762	2.48e-41	SMART
IG_FLMN	764	865	6.7e-29	SMART
IG_FLMN	867	964	3.42e-35	SMART
IG_FLMN	966	1060	2.92e-29	SMART
IG_FLMN	1062	1153	3.69e-40	SMART
IG_FLMN	1155	1248	6.53e-41	SMART
IG_FLMN	1250	1348	7.23e-34	SMART
IG_FLMN	1350	1441	2.04e-42	SMART
IG_FLMN	1443	1537	1.75e-41	SMART
IG_FLMN	1539	1634	1.31e-40	SMART
IG_FLMN	1636	1738	1.05e-30	SMART
IG_FLMN	1777	1858	2.93e-11	SMART
IG_FLMN	1859	1950	2.55e-43	SMART
IG_FLMN	1951	2037	2.43e-17	SMART
IG_FLMN	2041	2132	1.52e-41	SMART
PDB:2E9I\|A	2133	2162	3e-7	PDB
IG_FLMN	2217	2310	2.93e-11	SMART
IG_FLMN	2314	2405	1.67e-38	SMART
IG_FLMN	2408	2500	2.56e-25	SMART
IG_FLMN	2505	2596	9.54e-34	SMART
low complexity region	2618	2628	N/A	INTRINSIC
IG_FLMN	2635	2737	2.11e-26	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101617
AA Change: E1109G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699
AA Change: E1109G

Domain	Start	End	E-Value	Type
CH	39	141	1.17e-25	SMART
CH	162	258	2.09e-22	SMART
IG_FLMN	275	372	3.84e-38	SMART
IG_FLMN	375	472	3.73e-36	SMART
IG_FLMN	474	569	4.41e-38	SMART
IG_FLMN	571	662	3.61e-34	SMART
IG_FLMN	667	762	2.48e-41	SMART
IG_FLMN	764	865	6.7e-29	SMART
IG_FLMN	867	964	3.42e-35	SMART
IG_FLMN	966	1060	2.92e-29	SMART
IG_FLMN	1062	1153	3.69e-40	SMART
IG_FLMN	1155	1248	6.53e-41	SMART
IG_FLMN	1250	1348	7.23e-34	SMART
IG_FLMN	1350	1441	2.04e-42	SMART
IG_FLMN	1443	1537	1.75e-41	SMART
IG_FLMN	1539	1634	1.31e-40	SMART
IG_FLMN	1636	1738	6.11e-32	SMART
IG_FLMN	1744	1825	2.93e-11	SMART
IG_FLMN	1826	1917	2.55e-43	SMART
IG_FLMN	1918	2004	2.43e-17	SMART
IG_FLMN	2008	2099	1.52e-41	SMART
PDB:2E9I\|A	2100	2129	3e-7	PDB
IG_FLMN	2184	2277	2.93e-11	SMART
IG_FLMN	2281	2372	1.67e-38	SMART
IG_FLMN	2375	2467	2.56e-25	SMART
IG_FLMN	2472	2563	9.54e-34	SMART
low complexity region	2585	2595	N/A	INTRINSIC
IG_FLMN	2602	2704	2.11e-26	SMART

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417H12Rik	T	C	7: 107,624,690		probably benign	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Adgrf2	T	C	17: 42,711,193	I247V	probably benign	Het
Adgrv1	A	G	13: 81,270,738		probably null	Het
Ankrd22	T	A	19: 34,149,352	K26I	possibly damaging	Het
Arhgap32	T	A	9: 32,245,256		probably null	Het
Armc10	A	G	5: 21,661,524	Y262C	probably damaging	Het
Arrb2	A	G	11: 70,439,899	D374G	probably benign	Het
Ascc3	C	T	10: 50,749,131	R1675C	probably damaging	Het
Atg5	T	C	10: 44,363,050	*276R	probably null	Het
Bcl11b	G	A	12: 107,916,709	T377M	probably damaging	Het
C1s2	C	A	6: 124,635,114	E104*	probably null	Het
Carf	A	T	1: 60,141,367	H316L	probably damaging	Het
Ccdc77	A	T	6: 120,334,835	I234N	probably damaging	Het
Cd300c2	A	T	11: 114,997,000	V192E	possibly damaging	Het
Cep72	G	A	13: 74,059,465	R62C	probably damaging	Het
Clasp1	T	A	1: 118,508,910	L308*	probably null	Het
Clec2g	A	G	6: 128,979,448	S25G	probably benign	Het
Cngb1	T	C	8: 95,251,973	M1046V	probably damaging	Het
Cobll1	A	T	2: 65,097,693	D1095E	probably benign	Het
Cpeb2	A	G	5: 43,244,662	H662R	possibly damaging	Het
Cps1	A	T	1: 67,139,763	T45S	probably benign	Het
Cspp1	A	G	1: 10,082,328	Q368R	possibly damaging	Het
Dcaf6	C	A	1: 165,411,463		probably null	Het
Dcst1	T	C	3: 89,350,507	Y652C	possibly damaging	Het
Elf5	T	G	2: 103,449,573	Y225*	probably null	Het
Ermap	A	C	4: 119,188,818		probably benign	Het
Fam186b	A	T	15: 99,271,321	V915D	probably damaging	Het
Fbxo34	C	A	14: 47,529,454	N90K	probably benign	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Gabpb2	A	G	3: 95,190,636	V242A	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gm14409	T	C	2: 177,265,430	T92A	possibly damaging	Het
Gm21798	A	T	15: 64,817,883		probably benign	Het
Gm765	A	T	6: 98,238,119	M181K	probably damaging	Het
Gpr179	A	T	11: 97,346,661	S345T	possibly damaging	Het
Gusb	A	T	5: 129,998,118	F377L	probably damaging	Het
Hnrnpu	T	C	1: 178,329,373		probably benign	Het
Htr3b	C	T	9: 48,937,048		probably null	Het
Iqub	A	T	6: 24,501,369	V194D	probably damaging	Het
Itga2b	A	G	11: 102,461,159	V504A	probably benign	Het
Itga4	T	A	2: 79,288,248	F430L	probably damaging	Het
Jcad	C	A	18: 4,673,762	P508H	probably damaging	Het
Jph1	T	C	1: 17,091,611	T276A	probably damaging	Het
Kansl2	A	G	15: 98,531,890	F87S	possibly damaging	Het
Kdm1b	T	C	13: 47,063,144		probably null	Het
Kif5b	C	T	18: 6,220,930	D393N	probably benign	Het
Kmt2d	A	T	15: 98,849,539		probably benign	Het
Krt75	A	G	15: 101,570,239	I320T	probably damaging	Het
Lipo5	T	C	19: 33,465,948	N156S	unknown	Het
Mblac2	A	C	13: 81,711,587	Q19P	probably null	Het
Mfsd4b3	T	C	10: 39,948,060	H68R	probably damaging	Het
Mzb1	A	T	18: 35,647,953		probably null	Het
Nup210l	T	A	3: 90,170,030	I891N	probably benign	Het
Nwd1	G	A	8: 72,672,213	R667Q	probably damaging	Het
Oas1h	C	T	5: 120,867,109	Q207*	probably null	Het
Olfr159	A	T	4: 43,770,476	F178L	possibly damaging	Het
Pcdh15	C	T	10: 74,504,793	R1120*	probably null	Het
Pfkl	A	G	10: 77,988,310	L748P	probably damaging	Het
Phldb2	T	A	16: 45,751,395	K473N	probably damaging	Het
Rapgef6	G	A	11: 54,552,836	V82I	probably damaging	Het
Rfc3	A	T	5: 151,647,495	L112Q	probably damaging	Het
Rsph6a	T	A	7: 19,068,072	C349S	possibly damaging	Het
Sec16a	A	T	2: 26,441,967		probably benign	Het
Sept14	T	A	5: 129,692,966	Y222F	probably benign	Het
Skor2	T	C	18: 76,860,295	S571P	possibly damaging	Het
Slc13a5	T	A	11: 72,257,418	M264L	probably damaging	Het
Slc45a3	T	A	1: 131,981,577	V504E	probably damaging	Het
Smg1	C	T	7: 118,152,408		probably benign	Het
Smim20	A	G	5: 53,277,161	N45S	probably null	Het
Spp2	A	T	1: 88,412,269	S111C	probably damaging	Het
Sspo	A	G	6: 48,465,730		probably null	Het
Sycp2	C	T	2: 178,403,657		probably null	Het
Tas2r113	A	G	6: 132,893,558	N183S	possibly damaging	Het
Tcaf2	A	T	6: 42,629,745	M425K	probably benign	Het
Tdrp	A	G	8: 13,953,845	V164A	possibly damaging	Het
Tmbim1	A	G	1: 74,289,409	F298S	probably damaging	Het
Tmem211	T	A	5: 113,238,170	M161K	probably benign	Het
Tmem89	A	G	9: 108,914,761		probably benign	Het
Trpm2	G	T	10: 77,932,189	C825*	probably null	Het
Tsc1	A	G	2: 28,675,189	E421G	possibly damaging	Het
Usp24	T	C	4: 106,388,637	I1364T	probably benign	Het
Vmn1r52	G	A	6: 90,178,948	G78E	possibly damaging	Het
Vmn2r73	T	G	7: 85,857,621	I828L	probably damaging	Het
Vwa5b1	A	T	4: 138,610,747	D87E	probably benign	Het
Zfp451	A	T	1: 33,805,384	D47E	probably damaging	Het
Zfp821	A	G	8: 109,724,209	E278G	probably damaging	Het
Zfp930	A	T	8: 69,228,945	T430S	probably benign	Het
Zfp994	G	T	17: 22,200,467	Y500*	probably null	Het
Zmat3	A	T	3: 32,343,687	I142N	probably damaging	Het
Zzef1	T	A	11: 72,901,388	I2266N	probably damaging	Het

Other mutations in Flnc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Flnc	APN	6	29459547	nonsense	probably null
IGL01099:Flnc	APN	6	29433618	missense	probably damaging	0.99
IGL01656:Flnc	APN	6	29443508	splice site	probably benign
IGL01659:Flnc	APN	6	29448671	missense	probably damaging	0.98
IGL01780:Flnc	APN	6	29438493	nonsense	probably null
IGL01935:Flnc	APN	6	29454280	missense	probably damaging	1.00
IGL02039:Flnc	APN	6	29450719	missense	probably benign	0.05
IGL02119:Flnc	APN	6	29447512	missense	probably damaging	0.98
IGL02122:Flnc	APN	6	29444336	missense	possibly damaging	0.70
IGL02236:Flnc	APN	6	29454376	missense	probably damaging	1.00
IGL02350:Flnc	APN	6	29438493	nonsense	probably null
IGL02357:Flnc	APN	6	29438493	nonsense	probably null
IGL02428:Flnc	APN	6	29451485	missense	probably damaging	1.00
IGL02496:Flnc	APN	6	29440685	missense	probably damaging	0.98
IGL02516:Flnc	APN	6	29450841	missense	probably damaging	0.99
IGL02696:Flnc	APN	6	29446698	missense	probably damaging	0.98
IGL03165:Flnc	APN	6	29449378	missense	probably damaging	1.00
IGL03190:Flnc	APN	6	29445637	splice site	probably benign
I1329:Flnc	UTSW	6	29451415	missense	probably damaging	1.00
R0111:Flnc	UTSW	6	29454340	missense	probably damaging	0.99
R0665:Flnc	UTSW	6	29455531	missense	probably damaging	1.00
R0748:Flnc	UTSW	6	29446344	missense	probably damaging	0.99
R0960:Flnc	UTSW	6	29441512	missense	probably damaging	1.00
R1328:Flnc	UTSW	6	29438613	missense	probably damaging	1.00
R1502:Flnc	UTSW	6	29438694	missense	probably benign	0.45
R1544:Flnc	UTSW	6	29444080	missense	probably benign	0.00
R1565:Flnc	UTSW	6	29455171	missense	probably damaging	1.00
R1640:Flnc	UTSW	6	29433807	missense	possibly damaging	0.78
R1691:Flnc	UTSW	6	29441214	missense	probably benign	0.09
R1818:Flnc	UTSW	6	29457448	missense	probably damaging	1.00
R1826:Flnc	UTSW	6	29455185	missense	probably damaging	0.99
R1851:Flnc	UTSW	6	29443479	missense	probably damaging	1.00
R1898:Flnc	UTSW	6	29438666	nonsense	probably null
R1905:Flnc	UTSW	6	29459460	missense	probably damaging	1.00
R1985:Flnc	UTSW	6	29444416	splice site	probably benign
R2016:Flnc	UTSW	6	29443797	critical splice donor site	probably null
R2017:Flnc	UTSW	6	29443797	critical splice donor site	probably null
R2020:Flnc	UTSW	6	29444363	missense	probably damaging	0.97
R2104:Flnc	UTSW	6	29450735	critical splice donor site	probably null
R2132:Flnc	UTSW	6	29443676	missense	probably damaging	1.00
R2141:Flnc	UTSW	6	29448675	missense	probably damaging	1.00
R2197:Flnc	UTSW	6	29459135	missense	probably damaging	1.00
R2202:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2203:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2204:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2205:Flnc	UTSW	6	29459508	missense	probably damaging	1.00
R2209:Flnc	UTSW	6	29455845	missense	possibly damaging	0.91
R2248:Flnc	UTSW	6	29451401	missense	probably damaging	0.99
R2258:Flnc	UTSW	6	29438666	nonsense	probably null
R2259:Flnc	UTSW	6	29438666	nonsense	probably null
R2280:Flnc	UTSW	6	29438666	nonsense	probably null
R2281:Flnc	UTSW	6	29438666	nonsense	probably null
R2873:Flnc	UTSW	6	29447543	missense	probably damaging	0.96
R2900:Flnc	UTSW	6	29448585	missense	probably damaging	0.98
R3788:Flnc	UTSW	6	29454057	missense	probably damaging	0.99
R3799:Flnc	UTSW	6	29443739	missense	probably damaging	1.00
R3801:Flnc	UTSW	6	29447404	missense	probably damaging	0.98
R3851:Flnc	UTSW	6	29453719	missense	probably damaging	1.00
R3910:Flnc	UTSW	6	29459427	missense	probably damaging	1.00
R3982:Flnc	UTSW	6	29442941	missense	probably damaging	1.00
R3983:Flnc	UTSW	6	29442941	missense	probably damaging	1.00
R4023:Flnc	UTSW	6	29451635	missense	possibly damaging	0.95
R4676:Flnc	UTSW	6	29445154	splice site	probably null
R4694:Flnc	UTSW	6	29443448	missense	probably damaging	1.00
R4695:Flnc	UTSW	6	29440429	missense	probably damaging	0.99
R4735:Flnc	UTSW	6	29455813	missense	probably damaging	1.00
R4773:Flnc	UTSW	6	29445039	missense	possibly damaging	0.96
R4828:Flnc	UTSW	6	29455167	missense	probably damaging	1.00
R4856:Flnc	UTSW	6	29447890	missense	probably damaging	1.00
R4879:Flnc	UTSW	6	29460806	missense	probably damaging	0.99
R4899:Flnc	UTSW	6	29446843	missense	probably benign	0.17
R5089:Flnc	UTSW	6	29447813	missense	probably damaging	0.96
R5173:Flnc	UTSW	6	29455538	missense	probably damaging	1.00
R5174:Flnc	UTSW	6	29448894	missense	possibly damaging	0.91
R5290:Flnc	UTSW	6	29457554	missense	probably damaging	1.00
R5338:Flnc	UTSW	6	29444064	missense	possibly damaging	0.47
R5352:Flnc	UTSW	6	29449318	missense	possibly damaging	0.85
R5397:Flnc	UTSW	6	29441161	missense	possibly damaging	0.87
R5431:Flnc	UTSW	6	29456384	missense	possibly damaging	0.74
R5481:Flnc	UTSW	6	29441217	missense	probably damaging	1.00
R5511:Flnc	UTSW	6	29458898	missense	probably damaging	1.00
R5539:Flnc	UTSW	6	29446230	missense	probably damaging	1.00
R5549:Flnc	UTSW	6	29453691	missense	probably damaging	1.00
R5567:Flnc	UTSW	6	29444045	nonsense	probably null
R5584:Flnc	UTSW	6	29446628	missense	probably damaging	0.98
R5689:Flnc	UTSW	6	29441592	missense	probably benign	0.03
R5753:Flnc	UTSW	6	29433489	missense	probably benign
R5786:Flnc	UTSW	6	29459537	nonsense	probably null
R5822:Flnc	UTSW	6	29459430	missense	probably damaging	0.98
R5823:Flnc	UTSW	6	29461202	missense	probably damaging	0.99
R5933:Flnc	UTSW	6	29441106	missense	probably damaging	0.99
R6043:Flnc	UTSW	6	29446608	missense	probably damaging	1.00
R6320:Flnc	UTSW	6	29459063	missense	probably damaging	1.00
R6337:Flnc	UTSW	6	29454319	missense	probably damaging	0.99
R6399:Flnc	UTSW	6	29458883	missense	probably damaging	1.00
R6423:Flnc	UTSW	6	29445156	splice site	probably null
R6540:Flnc	UTSW	6	29446377	missense	possibly damaging	0.96
R6547:Flnc	UTSW	6	29448608	missense	probably damaging	0.98
R6717:Flnc	UTSW	6	29450902	small deletion	probably benign
R6875:Flnc	UTSW	6	29445749	missense	probably damaging	1.00
R7193:Flnc	UTSW	6	29450871	missense	probably damaging	1.00
R7255:Flnc	UTSW	6	29445766	missense	probably damaging	1.00
R7303:Flnc	UTSW	6	29460850	missense	probably benign	0.31
R7413:Flnc	UTSW	6	29452259	missense	probably damaging	1.00
R7422:Flnc	UTSW	6	29455471	missense	probably damaging	1.00
R7559:Flnc	UTSW	6	29459010	missense	probably damaging	1.00
R7632:Flnc	UTSW	6	29446985	missense	probably damaging	0.98
R7651:Flnc	UTSW	6	29444050	missense	probably benign	0.08
R7679:Flnc	UTSW	6	29456790	missense	probably benign	0.00
R7697:Flnc	UTSW	6	29456517	missense	probably damaging	0.98
R7788:Flnc	UTSW	6	29456444	missense	possibly damaging	0.67
Z1088:Flnc	UTSW	6	29457151	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCAAGTTCAGGGGACTAAC -3'
(R):5'- AGGATCTCGATGGTCAGCTC -3'

Sequencing Primer
(F):5'- GTTCAGGGGACTAACAAACATGTTC -3'
(R):5'- TTCTGAGCAGTCCACGGTGAAG -3'

Posted On

2016-04-15