Incidental Mutation 'R4906:Smg1'
ID 378199
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms 2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4906 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 118131308-118243670 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) C to T at 118152408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: S2810N
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: S2810N

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083940
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
R7798:Smg1 UTSW 7 118171939 missense possibly damaging 0.73
R7908:Smg1 UTSW 7 118186134 missense unknown
R7923:Smg1 UTSW 7 118143322 missense possibly damaging 0.96
R7978:Smg1 UTSW 7 118193655 missense unknown
R7997:Smg1 UTSW 7 118173141 missense unknown
R7997:Smg1 UTSW 7 118173142 missense unknown
R8025:Smg1 UTSW 7 118206989 nonsense probably null
R8056:Smg1 UTSW 7 118160366 missense unknown
R8061:Smg1 UTSW 7 118152387 missense unknown
R8095:Smg1 UTSW 7 118173062 missense unknown
R8198:Smg1 UTSW 7 118145606 missense probably benign 0.03
R8399:Smg1 UTSW 7 118190571 missense unknown
R8445:Smg1 UTSW 7 118136977 missense possibly damaging 0.72
R8519:Smg1 UTSW 7 118171759 utr 3 prime probably benign
R8817:Smg1 UTSW 7 118159664 missense unknown
R8832:Smg1 UTSW 7 118139783 missense probably benign 0.33
R8855:Smg1 UTSW 7 118206899 missense unknown
R8866:Smg1 UTSW 7 118206899 missense unknown
R8946:Smg1 UTSW 7 118152677 missense probably null
R8954:Smg1 UTSW 7 118206992 missense probably damaging 1.00
R8967:Smg1 UTSW 7 118166516 missense unknown
R9072:Smg1 UTSW 7 118183809 missense unknown
R9090:Smg1 UTSW 7 118212563 missense unknown
R9156:Smg1 UTSW 7 118154661 missense unknown
R9198:Smg1 UTSW 7 118195956 missense unknown
R9240:Smg1 UTSW 7 118139808 missense probably benign 0.18
R9271:Smg1 UTSW 7 118212563 missense unknown
R9289:Smg1 UTSW 7 118145416 missense possibly damaging 0.53
R9378:Smg1 UTSW 7 118178775 nonsense probably null
R9396:Smg1 UTSW 7 118208080 missense unknown
R9469:Smg1 UTSW 7 118140551 missense possibly damaging 0.72
R9539:Smg1 UTSW 7 118145753 missense probably benign 0.03
R9549:Smg1 UTSW 7 118196031 missense unknown
R9563:Smg1 UTSW 7 118212985 missense unknown
R9564:Smg1 UTSW 7 118212985 missense unknown
R9597:Smg1 UTSW 7 118213047 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Z1176:Smg1 UTSW 7 118206887 missense unknown
Z1176:Smg1 UTSW 7 118206907 missense unknown
Z1177:Smg1 UTSW 7 118168608 missense probably null
Z1177:Smg1 UTSW 7 118213033 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTGATAATCTGTTTTGCCG -3'
(R):5'- ACTTGGCCAGTGTTTGTCAC -3'

Sequencing Primer
(F):5'- CCAGTATTACAGGCTTGTGACAC -3'
(R):5'- GTCACTTTGAGATTTGAAGTCTTCTC -3'
Posted On 2016-04-15