Incidental Mutation 'R4906:Phldb2'
ID378236
Institutional Source Beutler Lab
Gene Symbol Phldb2
Ensembl Gene ENSMUSG00000033149
Gene Namepleckstrin homology like domain, family B, member 2
SynonymsLL5b, LL5beta, C820004H04Rik
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45746243-45953598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45751395 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 473 (K473N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036355] [ENSMUST00000076333]
Predicted Effect probably damaging
Transcript: ENSMUST00000036355
AA Change: K1158N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046496
Gene: ENSMUSG00000033149
AA Change: K1158N

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
coiled coil region 1027 1097 N/A INTRINSIC
PH 1140 1244 6.45e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076333
AA Change: K1211N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149
AA Change: K1211N

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131003
AA Change: K473N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119718
Gene: ENSMUSG00000033149
AA Change: K473N

DomainStartEndE-ValueType
coiled coil region 1 55 N/A INTRINSIC
coiled coil region 87 163 N/A INTRINSIC
coiled coil region 342 412 N/A INTRINSIC
PH 456 560 6.45e-17 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jcad C A 18: 4,673,762 P508H probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Phldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Phldb2 APN 16 45772254 missense probably damaging 1.00
IGL00485:Phldb2 APN 16 45757188 missense possibly damaging 0.75
IGL00544:Phldb2 APN 16 45825311 missense probably damaging 1.00
IGL00547:Phldb2 APN 16 45825535 missense probably benign 0.00
IGL00835:Phldb2 APN 16 45751456 missense probably damaging 1.00
IGL00987:Phldb2 APN 16 45763102 missense possibly damaging 0.78
IGL01102:Phldb2 APN 16 45825060 missense probably damaging 1.00
IGL01530:Phldb2 APN 16 45802729 missense probably damaging 1.00
IGL01549:Phldb2 APN 16 45774318 missense probably benign 0.00
IGL01712:Phldb2 APN 16 45751429 missense probably damaging 1.00
IGL01755:Phldb2 APN 16 45825582 missense probably damaging 0.96
IGL01823:Phldb2 APN 16 45825144 missense probably damaging 0.97
IGL02353:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02360:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02716:Phldb2 APN 16 45801590 missense probably damaging 0.99
R0139:Phldb2 UTSW 16 45770666 splice site probably benign
R0312:Phldb2 UTSW 16 45789047 missense probably damaging 1.00
R0379:Phldb2 UTSW 16 45781451 missense probably damaging 1.00
R0535:Phldb2 UTSW 16 45757127 missense probably damaging 1.00
R1387:Phldb2 UTSW 16 45825994 missense possibly damaging 0.69
R1444:Phldb2 UTSW 16 45757253 splice site probably benign
R1487:Phldb2 UTSW 16 45789024 missense probably damaging 1.00
R1501:Phldb2 UTSW 16 45777783 missense probably damaging 1.00
R1605:Phldb2 UTSW 16 45770779 splice site probably benign
R1716:Phldb2 UTSW 16 45775050 missense probably benign 0.01
R1732:Phldb2 UTSW 16 45757166 missense probably damaging 1.00
R1779:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R1824:Phldb2 UTSW 16 45826011 missense probably benign 0.14
R2001:Phldb2 UTSW 16 45774195 missense possibly damaging 0.66
R2066:Phldb2 UTSW 16 45770758 missense probably damaging 1.00
R2122:Phldb2 UTSW 16 45762941 missense probably damaging 0.99
R2448:Phldb2 UTSW 16 45825363 missense probably damaging 1.00
R2932:Phldb2 UTSW 16 45748785 missense possibly damaging 0.85
R3076:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3078:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3779:Phldb2 UTSW 16 45748755 missense probably damaging 1.00
R3914:Phldb2 UTSW 16 45757163 missense probably damaging 1.00
R4536:Phldb2 UTSW 16 45770681 missense probably benign 0.04
R4568:Phldb2 UTSW 16 45777718 nonsense probably null
R4798:Phldb2 UTSW 16 45825874 missense probably damaging 1.00
R4853:Phldb2 UTSW 16 45802716 missense probably damaging 0.99
R4984:Phldb2 UTSW 16 45825633 missense probably damaging 1.00
R5078:Phldb2 UTSW 16 45777742 missense possibly damaging 0.85
R5137:Phldb2 UTSW 16 45808258 missense possibly damaging 0.85
R5237:Phldb2 UTSW 16 45747886 missense probably damaging 0.99
R5410:Phldb2 UTSW 16 45825612 missense possibly damaging 0.77
R5825:Phldb2 UTSW 16 45763097 missense probably benign 0.11
R5874:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R5907:Phldb2 UTSW 16 45825188 missense probably damaging 1.00
R6332:Phldb2 UTSW 16 45774246 missense probably benign
R6354:Phldb2 UTSW 16 45825114 missense probably damaging 1.00
R6355:Phldb2 UTSW 16 45825338 missense probably damaging 0.99
R6383:Phldb2 UTSW 16 45748750 missense probably damaging 1.00
R6463:Phldb2 UTSW 16 45774993 missense probably benign 0.37
R6513:Phldb2 UTSW 16 45747877 missense possibly damaging 0.96
R6593:Phldb2 UTSW 16 45825427 nonsense probably null
R6756:Phldb2 UTSW 16 45808320 missense probably benign 0.02
R6810:Phldb2 UTSW 16 45748725 critical splice donor site probably null
R6897:Phldb2 UTSW 16 45777775 missense probably damaging 1.00
R7010:Phldb2 UTSW 16 45751505 missense probably damaging 0.99
R7142:Phldb2 UTSW 16 45757176 nonsense probably null
R7149:Phldb2 UTSW 16 45751532 nonsense probably null
R7249:Phldb2 UTSW 16 45801614 missense probably damaging 1.00
R7300:Phldb2 UTSW 16 45825562 missense probably damaging 1.00
R7328:Phldb2 UTSW 16 45758209 critical splice acceptor site probably null
R7515:Phldb2 UTSW 16 45774240 missense possibly damaging 0.90
R7840:Phldb2 UTSW 16 45751364 missense probably damaging 1.00
R7988:Phldb2 UTSW 16 45825571 missense probably benign 0.03
R8159:Phldb2 UTSW 16 45860384 missense possibly damaging 0.82
R8353:Phldb2 UTSW 16 45825022 missense probably benign 0.00
R8453:Phldb2 UTSW 16 45825022 missense probably benign 0.00
RF008:Phldb2 UTSW 16 45762974 missense probably damaging 1.00
Z1176:Phldb2 UTSW 16 45825826 missense probably benign 0.43
Z1176:Phldb2 UTSW 16 45825827 missense probably benign 0.04
Z1176:Phldb2 UTSW 16 45953508 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCTACCAAGTTATCATTGCC -3'
(R):5'- ACGGCCATCATCTATGCAC -3'

Sequencing Primer
(F):5'- AGATAGGGTCTCATCACCGTG -3'
(R):5'- CGGCCATCATCTATGCACTATAG -3'
Posted On2016-04-15