Incidental Mutation 'R4906:Jcad'
ID378240
Institutional Source Beutler Lab
Gene Symbol Jcad
Ensembl Gene ENSMUSG00000033960
Gene Namejunctional cadherin 5 associated
Synonyms9430020K01Rik
MMRRC Submission 042508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4906 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4634929-4682868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4673762 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 508 (P508H)
Ref Sequence ENSEMBL: ENSMUSP00000038613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037029]
Predicted Effect probably damaging
Transcript: ENSMUST00000037029
AA Change: P508H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038613
Gene: ENSMUSG00000033960
AA Change: P508H

DomainStartEndE-ValueType
Pfam:JCAD 1 1309 N/A PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T C 7: 107,624,690 probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adgrf2 T C 17: 42,711,193 I247V probably benign Het
Adgrv1 A G 13: 81,270,738 probably null Het
Ankrd22 T A 19: 34,149,352 K26I possibly damaging Het
Arhgap32 T A 9: 32,245,256 probably null Het
Armc10 A G 5: 21,661,524 Y262C probably damaging Het
Arrb2 A G 11: 70,439,899 D374G probably benign Het
Ascc3 C T 10: 50,749,131 R1675C probably damaging Het
Atg5 T C 10: 44,363,050 *276R probably null Het
Bcl11b G A 12: 107,916,709 T377M probably damaging Het
C1s2 C A 6: 124,635,114 E104* probably null Het
Carf A T 1: 60,141,367 H316L probably damaging Het
Ccdc77 A T 6: 120,334,835 I234N probably damaging Het
Cd300c2 A T 11: 114,997,000 V192E possibly damaging Het
Cep72 G A 13: 74,059,465 R62C probably damaging Het
Clasp1 T A 1: 118,508,910 L308* probably null Het
Clec2g A G 6: 128,979,448 S25G probably benign Het
Cngb1 T C 8: 95,251,973 M1046V probably damaging Het
Cobll1 A T 2: 65,097,693 D1095E probably benign Het
Cpeb2 A G 5: 43,244,662 H662R possibly damaging Het
Cps1 A T 1: 67,139,763 T45S probably benign Het
Cspp1 A G 1: 10,082,328 Q368R possibly damaging Het
Dcaf6 C A 1: 165,411,463 probably null Het
Dcst1 T C 3: 89,350,507 Y652C possibly damaging Het
Elf5 T G 2: 103,449,573 Y225* probably null Het
Ermap A C 4: 119,188,818 probably benign Het
Fam186b A T 15: 99,271,321 V915D probably damaging Het
Fbxo34 C A 14: 47,529,454 N90K probably benign Het
Flnc A G 6: 29,447,525 E1109G probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gabpb2 A G 3: 95,190,636 V242A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm14409 T C 2: 177,265,430 T92A possibly damaging Het
Gm21798 A T 15: 64,817,883 probably benign Het
Gm765 A T 6: 98,238,119 M181K probably damaging Het
Gpr179 A T 11: 97,346,661 S345T possibly damaging Het
Gusb A T 5: 129,998,118 F377L probably damaging Het
Hnrnpu T C 1: 178,329,373 probably benign Het
Htr3b C T 9: 48,937,048 probably null Het
Iqub A T 6: 24,501,369 V194D probably damaging Het
Itga2b A G 11: 102,461,159 V504A probably benign Het
Itga4 T A 2: 79,288,248 F430L probably damaging Het
Jph1 T C 1: 17,091,611 T276A probably damaging Het
Kansl2 A G 15: 98,531,890 F87S possibly damaging Het
Kdm1b T C 13: 47,063,144 probably null Het
Kif5b C T 18: 6,220,930 D393N probably benign Het
Kmt2d A T 15: 98,849,539 probably benign Het
Krt75 A G 15: 101,570,239 I320T probably damaging Het
Lipo5 T C 19: 33,465,948 N156S unknown Het
Mblac2 A C 13: 81,711,587 Q19P probably null Het
Mfsd4b3 T C 10: 39,948,060 H68R probably damaging Het
Mzb1 A T 18: 35,647,953 probably null Het
Nup210l T A 3: 90,170,030 I891N probably benign Het
Nwd1 G A 8: 72,672,213 R667Q probably damaging Het
Oas1h C T 5: 120,867,109 Q207* probably null Het
Olfr159 A T 4: 43,770,476 F178L possibly damaging Het
Pcdh15 C T 10: 74,504,793 R1120* probably null Het
Pfkl A G 10: 77,988,310 L748P probably damaging Het
Phldb2 T A 16: 45,751,395 K473N probably damaging Het
Rapgef6 G A 11: 54,552,836 V82I probably damaging Het
Rfc3 A T 5: 151,647,495 L112Q probably damaging Het
Rsph6a T A 7: 19,068,072 C349S possibly damaging Het
Sec16a A T 2: 26,441,967 probably benign Het
Sept14 T A 5: 129,692,966 Y222F probably benign Het
Skor2 T C 18: 76,860,295 S571P possibly damaging Het
Slc13a5 T A 11: 72,257,418 M264L probably damaging Het
Slc45a3 T A 1: 131,981,577 V504E probably damaging Het
Smg1 C T 7: 118,152,408 probably benign Het
Smim20 A G 5: 53,277,161 N45S probably null Het
Spp2 A T 1: 88,412,269 S111C probably damaging Het
Sspo A G 6: 48,465,730 probably null Het
Sycp2 C T 2: 178,403,657 probably null Het
Tas2r113 A G 6: 132,893,558 N183S possibly damaging Het
Tcaf2 A T 6: 42,629,745 M425K probably benign Het
Tdrp A G 8: 13,953,845 V164A possibly damaging Het
Tmbim1 A G 1: 74,289,409 F298S probably damaging Het
Tmem211 T A 5: 113,238,170 M161K probably benign Het
Tmem89 A G 9: 108,914,761 probably benign Het
Trpm2 G T 10: 77,932,189 C825* probably null Het
Tsc1 A G 2: 28,675,189 E421G possibly damaging Het
Usp24 T C 4: 106,388,637 I1364T probably benign Het
Vmn1r52 G A 6: 90,178,948 G78E possibly damaging Het
Vmn2r73 T G 7: 85,857,621 I828L probably damaging Het
Vwa5b1 A T 4: 138,610,747 D87E probably benign Het
Zfp451 A T 1: 33,805,384 D47E probably damaging Het
Zfp821 A G 8: 109,724,209 E278G probably damaging Het
Zfp930 A T 8: 69,228,945 T430S probably benign Het
Zfp994 G T 17: 22,200,467 Y500* probably null Het
Zmat3 A T 3: 32,343,687 I142N probably damaging Het
Zzef1 T A 11: 72,901,388 I2266N probably damaging Het
Other mutations in Jcad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Jcad APN 18 4675692 missense probably benign 0.14
IGL00672:Jcad APN 18 4674835 missense possibly damaging 0.77
IGL00782:Jcad APN 18 4675073 missense probably benign 0.00
IGL00825:Jcad APN 18 4673516 missense probably damaging 1.00
IGL01522:Jcad APN 18 4673312 missense probably damaging 0.97
IGL01796:Jcad APN 18 4672855 nonsense probably null
IGL01973:Jcad APN 18 4675514 missense probably benign 0.21
IGL02083:Jcad APN 18 4680266 utr 3 prime probably benign
IGL02625:Jcad APN 18 4674422 missense probably benign 0.03
IGL03002:Jcad APN 18 4675153 missense probably benign 0.00
IGL03325:Jcad APN 18 4673902 missense probably benign
R0304:Jcad UTSW 18 4673325 missense possibly damaging 0.75
R0487:Jcad UTSW 18 4673243 missense probably damaging 1.00
R0519:Jcad UTSW 18 4649122 start gained probably benign
R0664:Jcad UTSW 18 4676063 missense probably damaging 0.97
R1649:Jcad UTSW 18 4673309 missense probably damaging 1.00
R1710:Jcad UTSW 18 4674511 missense probably damaging 1.00
R1734:Jcad UTSW 18 4674526 missense probably damaging 1.00
R1823:Jcad UTSW 18 4675780 missense probably damaging 1.00
R1824:Jcad UTSW 18 4649293 missense probably benign
R1850:Jcad UTSW 18 4675730 missense possibly damaging 0.95
R1872:Jcad UTSW 18 4673048 missense probably benign
R1878:Jcad UTSW 18 4673857 missense possibly damaging 0.60
R1918:Jcad UTSW 18 4674292 missense probably damaging 1.00
R1967:Jcad UTSW 18 4675162 missense probably benign 0.07
R2420:Jcad UTSW 18 4675952 missense probably damaging 1.00
R2504:Jcad UTSW 18 4674026 missense probably damaging 0.99
R2936:Jcad UTSW 18 4675153 missense probably benign 0.00
R4420:Jcad UTSW 18 4676032 missense probably benign 0.00
R4668:Jcad UTSW 18 4680221 splice site probably null
R4670:Jcad UTSW 18 4674175 missense probably benign 0.03
R4671:Jcad UTSW 18 4674175 missense probably benign 0.03
R4707:Jcad UTSW 18 4649338 nonsense probably null
R4720:Jcad UTSW 18 4674055 missense probably benign 0.03
R4815:Jcad UTSW 18 4675223 missense possibly damaging 0.94
R5214:Jcad UTSW 18 4674134 missense probably damaging 1.00
R5439:Jcad UTSW 18 4675790 missense probably damaging 1.00
R5563:Jcad UTSW 18 4673944 missense possibly damaging 0.93
R5721:Jcad UTSW 18 4676044 missense possibly damaging 0.48
R5825:Jcad UTSW 18 4674896 missense probably benign 0.00
R5952:Jcad UTSW 18 4674554 missense probably damaging 1.00
R6661:Jcad UTSW 18 4675256 missense probably damaging 1.00
R6928:Jcad UTSW 18 4673372 missense probably benign 0.00
R7426:Jcad UTSW 18 4675529 missense probably benign 0.11
R7808:Jcad UTSW 18 4673113 missense probably damaging 1.00
R7943:Jcad UTSW 18 4672700 missense probably damaging 1.00
R8010:Jcad UTSW 18 4674581 missense probably benign
R8080:Jcad UTSW 18 4649270 missense probably benign 0.01
R8133:Jcad UTSW 18 4649384 missense probably benign 0.03
R8408:Jcad UTSW 18 4649402 missense possibly damaging 0.55
T0722:Jcad UTSW 18 4675531 missense probably benign 0.25
X0017:Jcad UTSW 18 4676044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATCCGACATATCAAACTAGCTCAG -3'
(R):5'- GCTCTGAACCCCAGTTTCAAAC -3'

Sequencing Primer
(F):5'- GCCCCCAGAATTCTATGAAGAGG -3'
(R):5'- GAACCCCAGTTTCAAACTTTCTGAG -3'
Posted On2016-04-15