Incidental Mutation 'R4917:Fer1l4'
ID 378263
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 042519-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4917 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155873220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1287 (K1287E)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611] [ENSMUST00000130764]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: K1287E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: K1287E

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130764
SMART Domains Protein: ENSMUSP00000114324
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
Blast:FerB 1 26 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132912
SMART Domains Protein: ENSMUSP00000123091
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,658,996 (GRCm39) V2783I probably benign Het
Ago4 A C 4: 126,400,635 (GRCm39) C693G probably damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Arfgef3 T A 10: 18,492,638 (GRCm39) I1258F probably damaging Het
Arhgef40 A G 14: 52,227,556 (GRCm39) E434G probably damaging Het
Bcas1 T C 2: 170,220,806 (GRCm39) D324G probably damaging Het
Bdp1 A T 13: 100,191,713 (GRCm39) V1422E probably damaging Het
Bfsp1 C T 2: 143,669,391 (GRCm39) R396Q probably benign Het
Bpifb9b T A 2: 154,156,026 (GRCm39) probably null Het
Cacna1s T A 1: 136,029,302 (GRCm39) probably null Het
Casp8 T C 1: 58,866,377 (GRCm39) F126S probably damaging Het
Cdh26 T C 2: 178,091,614 (GRCm39) S58P probably benign Het
Cds2 A G 2: 132,140,398 (GRCm39) T182A probably damaging Het
Cfap157 C T 2: 32,669,965 (GRCm39) R206H probably benign Het
Col7a1 G A 9: 108,795,532 (GRCm39) G1529E unknown Het
Crybg3 A G 16: 59,350,782 (GRCm39) F2567L probably benign Het
Cyp2e1 T C 7: 140,354,527 (GRCm39) S393P possibly damaging Het
D5Ertd579e A G 5: 36,773,160 (GRCm39) Y412H probably damaging Het
Dclk2 A T 3: 86,732,049 (GRCm39) probably null Het
Ddx50 A T 10: 62,463,450 (GRCm39) C414* probably null Het
Dip2c T A 13: 9,671,905 (GRCm39) probably null Het
Dmtn G T 14: 70,843,159 (GRCm39) P283Q probably damaging Het
Dspp C A 5: 104,325,789 (GRCm39) D717E unknown Het
Efcab11 T C 12: 99,685,321 (GRCm39) D151G probably damaging Het
Egfem1 T C 3: 29,206,042 (GRCm39) V93A probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Erlec1 A G 11: 30,884,710 (GRCm39) Y448H possibly damaging Het
Fn1 A T 1: 71,634,968 (GRCm39) probably null Het
Fut8 G T 12: 77,521,818 (GRCm39) A486S probably damaging Het
Gfra1 A T 19: 58,255,522 (GRCm39) S308R probably damaging Het
Gm10764 A G 10: 87,126,579 (GRCm39) noncoding transcript Het
Gm5958 C A 14: 100,073,189 (GRCm39) noncoding transcript Het
Gm6788 C T 19: 28,740,664 (GRCm39) noncoding transcript Het
Gsdmd A G 15: 75,736,241 (GRCm39) I123M probably benign Het
H2bc13 A T 13: 21,900,189 (GRCm39) V42E probably damaging Het
Hsf4 A G 8: 105,999,367 (GRCm39) E235G probably benign Het
Ighv1-83 T C 12: 115,927,580 (GRCm39) I57V probably benign Het
Inhca A C 9: 103,129,054 (GRCm39) Y235* probably null Het
Inpp5f A T 7: 128,286,840 (GRCm39) D573V probably damaging Het
Kcnj1 T A 9: 32,308,056 (GRCm39) L160Q probably damaging Het
Kcnmb3 A T 3: 32,526,653 (GRCm39) C179* probably null Het
Lrig1 A G 6: 94,586,700 (GRCm39) F659L probably damaging Het
Lrrc3 T C 10: 77,737,253 (GRCm39) D61G probably benign Het
Marchf4 T G 1: 72,467,938 (GRCm39) S365R probably benign Het
Mccc1 A G 3: 36,051,703 (GRCm39) L32S probably benign Het
Mei4 A G 9: 81,772,216 (GRCm39) T10A probably benign Het
Meis1 T C 11: 18,959,222 (GRCm39) probably benign Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mmp11 C T 10: 75,761,419 (GRCm39) A31T probably damaging Het
Mrps28 A G 3: 8,947,614 (GRCm39) probably benign Het
Mthfsl A C 9: 88,597,550 (GRCm39) L67V probably damaging Het
Ncaph2 A G 15: 89,244,574 (GRCm39) I11V probably damaging Het
Ncdn G A 4: 126,643,731 (GRCm39) L364F possibly damaging Het
Nfat5 T A 8: 108,051,284 (GRCm39) D47E probably damaging Het
Or51g2 A T 7: 102,622,614 (GRCm39) I195N possibly damaging Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Or5bw2 C T 7: 6,573,643 (GRCm39) L218F possibly damaging Het
Pcdhb3 A T 18: 37,435,452 (GRCm39) I473F probably damaging Het
Pcdhgb8 A T 18: 37,897,191 (GRCm39) N754Y probably damaging Het
Pgbd5 C A 8: 125,097,305 (GRCm39) K408N probably benign Het
Pnisr A G 4: 21,859,330 (GRCm39) probably benign Het
Poldip3 A T 15: 83,016,776 (GRCm39) probably null Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Psmc3 A G 2: 90,896,317 (GRCm39) probably benign Het
Rab3gap1 T A 1: 127,816,914 (GRCm39) W58R possibly damaging Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Rhot1 A G 11: 80,100,027 (GRCm39) probably benign Het
Rsf1 T C 7: 97,311,612 (GRCm39) S781P probably damaging Het
Rtraf T C 14: 19,873,784 (GRCm39) K5R probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryr2 A G 13: 11,609,872 (GRCm39) V753A probably damaging Het
Ryr3 T C 2: 112,661,530 (GRCm39) H1820R probably damaging Het
Schip1 A T 3: 68,315,818 (GRCm39) probably benign Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Selp A C 1: 163,972,475 (GRCm39) T705P probably damaging Het
Sh3rf3 A T 10: 58,842,925 (GRCm39) D297V probably damaging Het
Slc24a4 T A 12: 102,231,203 (GRCm39) probably null Het
Slc2a9 C A 5: 38,574,603 (GRCm39) L224F probably benign Het
Slc35e2 C A 4: 155,700,693 (GRCm39) P272Q probably damaging Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Syne1 C T 10: 5,007,909 (GRCm39) C7932Y probably damaging Het
Tc2n A G 12: 101,631,954 (GRCm39) L301P probably damaging Het
Tchhl1 A G 3: 93,377,623 (GRCm39) D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 (GRCm38) I83V probably damaging Het
Tm4sf1 C T 3: 57,200,448 (GRCm39) G85S probably damaging Het
Tmem63a T A 1: 180,794,086 (GRCm39) I541N probably benign Het
Tmpo A G 10: 90,985,411 (GRCm39) V357A probably damaging Het
Unc80 T C 1: 66,685,709 (GRCm39) Y2278H possibly damaging Het
Vmn1r26 A G 6: 57,985,808 (GRCm39) F127S probably damaging Het
Vmn2r8 A T 5: 108,945,264 (GRCm39) M781K probably damaging Het
Vps36 T G 8: 22,708,280 (GRCm39) M348R possibly damaging Het
Vps45 T C 3: 95,926,943 (GRCm39) T535A probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTGAACACACAGGGGTC -3'
(R):5'- TCCGGAGTCTGCTTTCTACTGG -3'

Sequencing Primer
(F):5'- CAGGGGTCTGTTGCCTGAGAC -3'
(R):5'- TGGCCTAAACTCATGGCATC -3'
Posted On 2016-04-15