Incidental Mutation 'R4917:Fer1l4'
ID378263
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
MMRRC Submission 042519-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4917 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156031300 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1287 (K1287E)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611] [ENSMUST00000130764]
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: K1287E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: K1287E

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130764
SMART Domains Protein: ENSMUSP00000114324
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
Blast:FerB 1 26 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132912
SMART Domains Protein: ENSMUSP00000123091
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
Adgrv1 C T 13: 81,510,877 V2783I probably benign Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cacna1s T A 1: 136,101,564 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cds2 A G 2: 132,298,478 T182A probably damaging Het
Cfap157 C T 2: 32,779,953 R206H probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Crybg3 A G 16: 59,530,419 F2567L probably benign Het
Cyp2e1 T C 7: 140,774,614 S393P possibly damaging Het
D5Ertd579e A G 5: 36,615,816 Y412H probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Dip2c T A 13: 9,621,869 probably null Het
Dmtn G T 14: 70,605,719 P283Q probably damaging Het
Dspp C A 5: 104,177,923 D717E unknown Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erlec1 A G 11: 30,934,710 Y448H possibly damaging Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm5958 C A 14: 99,835,753 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hist1h2bl A T 13: 21,716,019 V42E probably damaging Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ighv1-83 T C 12: 115,963,960 I57V probably benign Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kcnmb3 A T 3: 32,472,504 C179* probably null Het
Lrig1 A G 6: 94,609,719 F659L probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mrps28 A G 3: 8,882,554 probably benign Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Ncaph2 A G 15: 89,360,371 I11V probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Pcdhb3 A T 18: 37,302,399 I473F probably damaging Het
Pcdhgb8 A T 18: 37,764,138 N754Y probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pnisr A G 4: 21,859,330 probably benign Het
Poldip3 A T 15: 83,132,575 probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Psmc3 A G 2: 91,065,972 probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rhot1 A G 11: 80,209,201 probably benign Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rtraf T C 14: 19,823,716 K5R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Ryr3 T C 2: 112,831,185 H1820R probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Selp A C 1: 164,144,906 T705P probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc24a4 T A 12: 102,264,944 probably null Het
Slc2a9 C A 5: 38,417,260 L224F probably benign Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Syne1 C T 10: 5,057,909 C7932Y probably damaging Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Vmn1r26 A G 6: 58,008,823 F127S probably damaging Het
Vmn2r8 A T 5: 108,797,398 M781K probably damaging Het
Vps36 T G 8: 22,218,264 M348R possibly damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0800:Fer1l4 UTSW 2 156045663 missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 156049478 critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 156048274 missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3806:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5555:Fer1l4 UTSW 2 156048189 missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 156047865 critical splice donor site probably null
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
R7631:Fer1l4 UTSW 2 156048275 missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 156020431 missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 156048934 missense probably benign
R8021:Fer1l4 UTSW 2 156022591 missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 156024635 missense probably benign 0.03
R8171:Fer1l4 UTSW 2 156048231 missense probably benign 0.29
R8241:Fer1l4 UTSW 2 156049665 missense probably benign
R8245:Fer1l4 UTSW 2 156045014 critical splice donor site probably null
R8280:Fer1l4 UTSW 2 156049700 missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 156019760 missense probably benign 0.17
R8403:Fer1l4 UTSW 2 156052243 missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 156019390 missense probably benign 0.00
R8804:Fer1l4 UTSW 2 156051994 missense probably benign 0.28
R8814:Fer1l4 UTSW 2 156052243 missense probably benign 0.04
R8817:Fer1l4 UTSW 2 156048223 missense probably damaging 0.99
RF030:Fer1l4 UTSW 2 156045529 small deletion probably benign
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 156048429 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTGAACACACAGGGGTC -3'
(R):5'- TCCGGAGTCTGCTTTCTACTGG -3'

Sequencing Primer
(F):5'- CAGGGGTCTGTTGCCTGAGAC -3'
(R):5'- TGGCCTAAACTCATGGCATC -3'
Posted On2016-04-15