Incidental Mutation 'R4917:Ncdn'
ID378278
Institutional Source Beutler Lab
Gene Symbol Ncdn
Ensembl Gene ENSMUSG00000028833
Gene Nameneurochondrin
Synonymsnorbin, neurochondrin-1, neurochondrin-2
MMRRC Submission 042519-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4917 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126743750-126753438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126749938 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 364 (L364F)
Ref Sequence ENSEMBL: ENSMUSP00000101722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030637] [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608] [ENSMUST00000106116] [ENSMUST00000132660] [ENSMUST00000148935] [ENSMUST00000154640]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030637
AA Change: L364F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030637
Gene: ENSMUSG00000028833
AA Change: L364F

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 3e-209 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047431
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102607
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102608
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106116
AA Change: L364F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101722
Gene: ENSMUSG00000028833
AA Change: L364F

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 9.1e-217 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131900
Predicted Effect probably benign
Transcript: ENSMUST00000132660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136035
Predicted Effect probably benign
Transcript: ENSMUST00000148935
Predicted Effect probably benign
Transcript: ENSMUST00000154640
SMART Domains Protein: ENSMUSP00000122352
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
Meta Mutation Damage Score 0.2488 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich cytoplasmic protein, which is highly similar to a mouse protein that negatively regulates Ca/calmodulin-dependent protein kinase II phosphorylation and may be essential for spatial learning processes. Several alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene results in early embryonic lethality in the homozygous state and impaired chondrocyte proliferation and differentiation in the heterozygous state. Gene trap mutation resulted in lacrimal gland hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
Adgrv1 C T 13: 81,510,877 V2783I probably benign Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cacna1s T A 1: 136,101,564 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cds2 A G 2: 132,298,478 T182A probably damaging Het
Cfap157 C T 2: 32,779,953 R206H probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Crybg3 A G 16: 59,530,419 F2567L probably benign Het
Cyp2e1 T C 7: 140,774,614 S393P possibly damaging Het
D5Ertd579e A G 5: 36,615,816 Y412H probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Dip2c T A 13: 9,621,869 probably null Het
Dmtn G T 14: 70,605,719 P283Q probably damaging Het
Dspp C A 5: 104,177,923 D717E unknown Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erlec1 A G 11: 30,934,710 Y448H possibly damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm5958 C A 14: 99,835,753 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hist1h2bl A T 13: 21,716,019 V42E probably damaging Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ighv1-83 T C 12: 115,963,960 I57V probably benign Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kcnmb3 A T 3: 32,472,504 C179* probably null Het
Lrig1 A G 6: 94,609,719 F659L probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mrps28 A G 3: 8,882,554 probably benign Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Ncaph2 A G 15: 89,360,371 I11V probably damaging Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Pcdhb3 A T 18: 37,302,399 I473F probably damaging Het
Pcdhgb8 A T 18: 37,764,138 N754Y probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pnisr A G 4: 21,859,330 probably benign Het
Poldip3 A T 15: 83,132,575 probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Psmc3 A G 2: 91,065,972 probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rhot1 A G 11: 80,209,201 probably benign Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rtraf T C 14: 19,823,716 K5R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Ryr3 T C 2: 112,831,185 H1820R probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Selp A C 1: 164,144,906 T705P probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc24a4 T A 12: 102,264,944 probably null Het
Slc2a9 C A 5: 38,417,260 L224F probably benign Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Syne1 C T 10: 5,057,909 C7932Y probably damaging Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Vmn1r26 A G 6: 58,008,823 F127S probably damaging Het
Vmn2r8 A T 5: 108,797,398 M781K probably damaging Het
Vps36 T G 8: 22,218,264 M348R possibly damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Other mutations in Ncdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ncdn APN 4 126747188 missense probably benign 0.00
R0031:Ncdn UTSW 4 126750108 unclassified probably null
R0135:Ncdn UTSW 4 126746669 missense probably benign 0.37
R0413:Ncdn UTSW 4 126750534 missense possibly damaging 0.52
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1486:Ncdn UTSW 4 126748598 missense probably damaging 1.00
R1533:Ncdn UTSW 4 126748698 nonsense probably null
R1785:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1786:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1789:Ncdn UTSW 4 126752003 missense probably damaging 1.00
R1791:Ncdn UTSW 4 126751939 critical splice donor site probably null
R3406:Ncdn UTSW 4 126748595 missense probably benign 0.09
R4547:Ncdn UTSW 4 126746674 missense probably damaging 1.00
R4863:Ncdn UTSW 4 126750423 missense probably damaging 1.00
R4916:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4918:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R5218:Ncdn UTSW 4 126750810 missense probably benign 0.13
R5356:Ncdn UTSW 4 126747228 missense probably damaging 1.00
R5617:Ncdn UTSW 4 126745047 missense probably damaging 0.99
R5718:Ncdn UTSW 4 126749950 nonsense probably null
R6057:Ncdn UTSW 4 126745031 missense probably benign 0.05
R6343:Ncdn UTSW 4 126747171 missense possibly damaging 0.74
R6986:Ncdn UTSW 4 126747229 missense probably damaging 1.00
R6988:Ncdn UTSW 4 126747189 missense probably benign 0.00
Z1176:Ncdn UTSW 4 126750151 missense probably damaging 1.00
Z1176:Ncdn UTSW 4 126750153 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGAACAGTCTGCTTCGACTTG -3'
(R):5'- TCTGGGAGCAAGTTTCTGGC -3'

Sequencing Primer
(F):5'- TGTGCTGTGATCAGAGAGC -3'
(R):5'- TGGCCCTGCTCGTGAATCTAG -3'
Posted On2016-04-15