Incidental Mutation 'R4917:Col7a1'
ID378302
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Namecollagen, type VII, alpha 1
Synonyms
MMRRC Submission 042519-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4917 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108953586-108984875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108966464 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 1529 (G1529E)
Ref Sequence ENSEMBL: ENSMUSP00000107701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
Predicted Effect unknown
Transcript: ENSMUST00000026740
AA Change: G1529E
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: G1529E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102188
Predicted Effect unknown
Transcript: ENSMUST00000112070
AA Change: G1529E
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: G1529E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127905
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
Adgrv1 C T 13: 81,510,877 V2783I probably benign Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cacna1s T A 1: 136,101,564 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cds2 A G 2: 132,298,478 T182A probably damaging Het
Cfap157 C T 2: 32,779,953 R206H probably benign Het
Crybg3 A G 16: 59,530,419 F2567L probably benign Het
Cyp2e1 T C 7: 140,774,614 S393P possibly damaging Het
D5Ertd579e A G 5: 36,615,816 Y412H probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Dip2c T A 13: 9,621,869 probably null Het
Dmtn G T 14: 70,605,719 P283Q probably damaging Het
Dspp C A 5: 104,177,923 D717E unknown Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erlec1 A G 11: 30,934,710 Y448H possibly damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm5958 C A 14: 99,835,753 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hist1h2bl A T 13: 21,716,019 V42E probably damaging Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ighv1-83 T C 12: 115,963,960 I57V probably benign Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kcnmb3 A T 3: 32,472,504 C179* probably null Het
Lrig1 A G 6: 94,609,719 F659L probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mrps28 A G 3: 8,882,554 probably benign Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Ncaph2 A G 15: 89,360,371 I11V probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Pcdhb3 A T 18: 37,302,399 I473F probably damaging Het
Pcdhgb8 A T 18: 37,764,138 N754Y probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pnisr A G 4: 21,859,330 probably benign Het
Poldip3 A T 15: 83,132,575 probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Psmc3 A G 2: 91,065,972 probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rhot1 A G 11: 80,209,201 probably benign Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rtraf T C 14: 19,823,716 K5R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Ryr3 T C 2: 112,831,185 H1820R probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Selp A C 1: 164,144,906 T705P probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc24a4 T A 12: 102,264,944 probably null Het
Slc2a9 C A 5: 38,417,260 L224F probably benign Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Syne1 C T 10: 5,057,909 C7932Y probably damaging Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Vmn1r26 A G 6: 58,008,823 F127S probably damaging Het
Vmn2r8 A T 5: 108,797,398 M781K probably damaging Het
Vps36 T G 8: 22,218,264 M348R possibly damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108963007 missense unknown
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108968607 missense possibly damaging 0.72
R4896:Col7a1 UTSW 9 108957277 missense unknown
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4915:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6247:Col7a1 UTSW 9 108981062 unclassified probably benign
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6518:Col7a1 UTSW 9 108955527 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108983919 critical splice donor site probably null
R7028:Col7a1 UTSW 9 108963263 nonsense probably null
R7556:Col7a1 UTSW 9 108982465 splice site probably null
R7571:Col7a1 UTSW 9 108982707 missense probably null
R7815:Col7a1 UTSW 9 108969565 missense probably damaging 0.96
R7875:Col7a1 UTSW 9 108958695 missense unknown
R7958:Col7a1 UTSW 9 108958695 missense unknown
R8016:Col7a1 UTSW 9 108958644 missense unknown
R8038:Col7a1 UTSW 9 108957292 missense unknown
R8049:Col7a1 UTSW 9 108975563 missense unknown
RF008:Col7a1 UTSW 9 108964479 missense unknown
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Z1177:Col7a1 UTSW 9 108974923 missense unknown
Z1177:Col7a1 UTSW 9 108976051 missense unknown
Z1177:Col7a1 UTSW 9 108984077 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGACCCCTTTCTAACCTG -3'
(R):5'- AGAACCATGTTGGATCAGGACC -3'

Sequencing Primer
(F):5'- ACCAATGTTTCTCTTCCCCAGGG -3'
(R):5'- ATGTTGGATCAGGACCCCATCTG -3'
Posted On2016-04-15