Incidental Mutation 'R4917:Ddx50'
ID378306
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 50
SynonymsGU2, RH-II/Gubeta, 8430408E17Rik, 4933429B04Rik
MMRRC Submission 042519-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4917 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62615895-62651218 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 62627671 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 414 (C414*)
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
Predicted Effect probably null
Transcript: ENSMUST00000020270
AA Change: C414*
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076
AA Change: C414*

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218372
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
Adgrv1 C T 13: 81,510,877 V2783I probably benign Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cacna1s T A 1: 136,101,564 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cds2 A G 2: 132,298,478 T182A probably damaging Het
Cfap157 C T 2: 32,779,953 R206H probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Crybg3 A G 16: 59,530,419 F2567L probably benign Het
Cyp2e1 T C 7: 140,774,614 S393P possibly damaging Het
D5Ertd579e A G 5: 36,615,816 Y412H probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Dip2c T A 13: 9,621,869 probably null Het
Dmtn G T 14: 70,605,719 P283Q probably damaging Het
Dspp C A 5: 104,177,923 D717E unknown Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erlec1 A G 11: 30,934,710 Y448H possibly damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm5958 C A 14: 99,835,753 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hist1h2bl A T 13: 21,716,019 V42E probably damaging Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ighv1-83 T C 12: 115,963,960 I57V probably benign Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kcnmb3 A T 3: 32,472,504 C179* probably null Het
Lrig1 A G 6: 94,609,719 F659L probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mrps28 A G 3: 8,882,554 probably benign Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Ncaph2 A G 15: 89,360,371 I11V probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Pcdhb3 A T 18: 37,302,399 I473F probably damaging Het
Pcdhgb8 A T 18: 37,764,138 N754Y probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pnisr A G 4: 21,859,330 probably benign Het
Poldip3 A T 15: 83,132,575 probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Psmc3 A G 2: 91,065,972 probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rhot1 A G 11: 80,209,201 probably benign Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rtraf T C 14: 19,823,716 K5R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Ryr3 T C 2: 112,831,185 H1820R probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Selp A C 1: 164,144,906 T705P probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc24a4 T A 12: 102,264,944 probably null Het
Slc2a9 C A 5: 38,417,260 L224F probably benign Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Syne1 C T 10: 5,057,909 C7932Y probably damaging Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Vmn1r26 A G 6: 58,008,823 F127S probably damaging Het
Vmn2r8 A T 5: 108,797,398 M781K probably damaging Het
Vps36 T G 8: 22,218,264 M348R possibly damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62647132 missense probably benign
IGL01955:Ddx50 APN 10 62647183 missense probably benign
IGL02677:Ddx50 APN 10 62616293 missense unknown
IGL03169:Ddx50 APN 10 62621387 critical splice donor site probably null
IGL03372:Ddx50 APN 10 62643330 missense probably benign 0.11
K7371:Ddx50 UTSW 10 62621510 start codon destroyed probably null
R0123:Ddx50 UTSW 10 62621377 splice site probably benign
R0134:Ddx50 UTSW 10 62621377 splice site probably benign
R0318:Ddx50 UTSW 10 62642837 missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62616249 missense unknown
R1244:Ddx50 UTSW 10 62642924 missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62647068 missense possibly damaging 0.45
R2005:Ddx50 UTSW 10 62640464 missense probably benign 0.10
R2924:Ddx50 UTSW 10 62627594 missense probably damaging 1.00
R3803:Ddx50 UTSW 10 62639944 missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62642946 missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62640770 nonsense probably null
R4918:Ddx50 UTSW 10 62627671 nonsense probably null
R4951:Ddx50 UTSW 10 62634120 missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62642853 missense probably damaging 1.00
R5102:Ddx50 UTSW 10 62640861 missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62647030 missense probably benign
R5648:Ddx50 UTSW 10 62616270 missense unknown
R5899:Ddx50 UTSW 10 62640817 nonsense probably null
R6127:Ddx50 UTSW 10 62621563 splice site probably null
R6244:Ddx50 UTSW 10 62621566 splice site probably null
R8098:Ddx50 UTSW 10 62625143 critical splice donor site probably null
R8163:Ddx50 UTSW 10 62639899 missense possibly damaging 0.93
R8257:Ddx50 UTSW 10 62616520 splice site probably benign
R8272:Ddx50 UTSW 10 62621477 missense probably benign 0.05
R8356:Ddx50 UTSW 10 62621508 missense probably benign 0.04
R8537:Ddx50 UTSW 10 62642849 missense probably damaging 1.00
R8540:Ddx50 UTSW 10 62640790 missense possibly damaging 0.94
R8759:Ddx50 UTSW 10 62616242 missense unknown
X0026:Ddx50 UTSW 10 62625191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAAACCACATCCCATGTCCTA -3'
(R):5'- ATTTAGTGTACATGCACCTGGA -3'

Sequencing Primer
(F):5'- CTACCTGTGGAGGAGAACTCTGAATC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2016-04-15