Incidental Mutation 'R0243:Spag17'
ID 37835
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Name sperm associated antigen 17
Synonyms PF6, 4931427F14Rik
MMRRC Submission 038481-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0243 (G1)
Quality Score 89
Status Validated
Chromosome 3
Chromosomal Location 99792722-100050638 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99992684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1727 (T1727A)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
AlphaFold Q5S003
Predicted Effect probably benign
Transcript: ENSMUST00000164539
AA Change: T1727A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: T1727A

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 98% (148/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T G 5: 64,055,806 (GRCm39) Y181D probably benign Het
1700029H14Rik A G 8: 13,604,715 (GRCm39) V196A possibly damaging Het
2410004B18Rik A G 3: 145,643,833 (GRCm39) D7G probably damaging Het
Acap1 A G 11: 69,776,252 (GRCm39) V249A probably damaging Het
Acat2 A T 17: 13,162,908 (GRCm39) D313E probably benign Het
Actn4 T C 7: 28,604,823 (GRCm39) T325A probably benign Het
Adamdec1 C T 14: 68,819,407 (GRCm39) probably null Het
Adat2 A G 10: 13,429,037 (GRCm39) T10A probably benign Het
Aff4 T A 11: 53,288,685 (GRCm39) S400R possibly damaging Het
Agbl2 C T 2: 90,621,825 (GRCm39) P104L possibly damaging Het
Alox12 G T 11: 70,133,542 (GRCm39) T594K possibly damaging Het
Als2 C A 1: 59,254,546 (GRCm39) K270N probably benign Het
Ankhd1 T A 18: 36,767,787 (GRCm39) C1235S probably damaging Het
Ankrd24 T A 10: 81,470,778 (GRCm39) I69N probably damaging Het
Aox4 G A 1: 58,252,235 (GRCm39) V37I probably benign Het
Arfgap3 A G 15: 83,214,714 (GRCm39) probably benign Het
Arhgef4 T A 1: 34,846,080 (GRCm39) probably null Het
Asic1 C T 15: 99,596,498 (GRCm39) probably benign Het
Atp8b5 A G 4: 43,366,057 (GRCm39) N776S probably benign Het
Bbs7 A G 3: 36,659,883 (GRCm39) I184T probably benign Het
Bbs9 A T 9: 22,425,297 (GRCm39) H117L probably damaging Het
Bnip2 T C 9: 69,902,787 (GRCm39) W10R probably damaging Het
Brd4 G T 17: 32,443,097 (GRCm39) Q175K probably benign Het
Bysl A T 17: 47,917,821 (GRCm39) V124E possibly damaging Het
Cadm3 A G 1: 173,174,140 (GRCm39) probably benign Het
Cc2d2a T C 5: 43,853,980 (GRCm39) probably benign Het
Ccdc134 G T 15: 82,025,147 (GRCm39) E215D probably damaging Het
Celsr3 G T 9: 108,720,923 (GRCm39) probably benign Het
Cntn5 T A 9: 9,781,780 (GRCm39) D428V probably damaging Het
Cog1 A G 11: 113,547,821 (GRCm39) probably benign Het
Col11a2 G T 17: 34,281,520 (GRCm39) probably benign Het
Cyp4f13 G A 17: 33,143,943 (GRCm39) probably benign Het
Dffb T A 4: 154,049,835 (GRCm39) K343* probably null Het
Dnah9 T A 11: 65,802,678 (GRCm39) I224F possibly damaging Het
Dolk A T 2: 30,176,031 (GRCm39) C5S probably benign Het
Dynlt2b A G 16: 32,245,705 (GRCm39) D118G probably damaging Het
Ebf1 A T 11: 44,759,915 (GRCm39) probably benign Het
Elac1 A G 18: 73,875,434 (GRCm39) L199P probably damaging Het
Elmod1 A C 9: 53,842,831 (GRCm39) probably benign Het
Ep400 A C 5: 110,872,273 (GRCm39) probably benign Het
F10 A T 8: 13,098,196 (GRCm39) N133I probably damaging Het
Fasn A G 11: 120,706,141 (GRCm39) Y1068H probably benign Het
Fbxo24 T C 5: 137,622,819 (GRCm39) E12G probably damaging Het
Fer G T 17: 64,385,941 (GRCm39) L304F probably benign Het
Filip1 A C 9: 79,726,285 (GRCm39) L778R probably damaging Het
Fli1 A T 9: 32,335,277 (GRCm39) I385N probably benign Het
Fpgs A T 2: 32,582,506 (GRCm39) L89* probably null Het
Gab2 T G 7: 96,948,448 (GRCm39) I346R probably damaging Het
Gm10764 G A 10: 87,126,841 (GRCm39) G83R unknown Het
Gpr83 G T 9: 14,776,138 (GRCm39) C153F possibly damaging Het
Gtf3c3 A G 1: 54,442,695 (GRCm39) L783P possibly damaging Het
Gys2 A G 6: 142,418,394 (GRCm39) probably benign Het
Heatr9 C T 11: 83,404,164 (GRCm39) V378I possibly damaging Het
Helz A T 11: 107,528,740 (GRCm39) Y920F possibly damaging Het
Inpp5f A T 7: 128,296,907 (GRCm39) Q459L probably damaging Het
Ints12 T C 3: 132,814,806 (GRCm39) S338P probably benign Het
Kif13a T C 13: 46,944,827 (GRCm39) T925A probably benign Het
Kif1a C T 1: 92,969,815 (GRCm39) V1051I probably damaging Het
Kif7 T A 7: 79,349,308 (GRCm39) H1119L possibly damaging Het
Kmt2d C T 15: 98,748,018 (GRCm39) probably benign Het
Krt90 C T 15: 101,471,110 (GRCm39) G51S possibly damaging Het
Krtap31-2 A T 11: 99,827,572 (GRCm39) I135F possibly damaging Het
Lrp2 T C 2: 69,258,974 (GRCm39) E4572G probably benign Het
Mapk8ip1 T C 2: 92,216,289 (GRCm39) E493G probably damaging Het
Matk T G 10: 81,094,326 (GRCm39) L28V probably benign Het
Mcc T A 18: 44,892,366 (GRCm39) T83S probably benign Het
Mtch1 A T 17: 29,559,080 (GRCm39) M204K possibly damaging Het
Muc4 T G 16: 32,586,120 (GRCm39) C2622G possibly damaging Het
Myo5a G A 9: 75,093,405 (GRCm39) probably null Het
Myoz3 T C 18: 60,712,023 (GRCm39) Y185C probably damaging Het
Nnmt A G 9: 48,503,438 (GRCm39) V196A probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Nup214 T A 2: 31,888,069 (GRCm39) probably benign Het
Or2aj4 T G 16: 19,385,044 (GRCm39) E196D probably damaging Het
Or2y13 T C 11: 49,414,739 (GRCm39) L63P probably damaging Het
Or4c126 T A 2: 89,824,150 (GRCm39) F138I probably benign Het
Pank3 T C 11: 35,672,543 (GRCm39) probably benign Het
Parm1 A T 5: 91,742,153 (GRCm39) N174Y possibly damaging Het
Pcgf2 A T 11: 97,583,244 (GRCm39) probably null Het
Pclo A T 5: 14,825,434 (GRCm39) K4661M unknown Het
Pcsk7 A C 9: 45,827,357 (GRCm39) S375R probably damaging Het
Pdzrn4 G T 15: 92,668,200 (GRCm39) S784I possibly damaging Het
Pex6 T A 17: 47,034,663 (GRCm39) probably null Het
Pi4ka C T 16: 17,115,499 (GRCm39) V1384M probably benign Het
Polr3f T A 2: 144,378,195 (GRCm39) probably benign Het
Ppp2r3d A T 9: 101,089,483 (GRCm39) V280E probably damaging Het
Prdm14 C T 1: 13,192,672 (GRCm39) G356R probably damaging Het
Prepl A G 17: 85,372,466 (GRCm39) probably null Het
Primpol T C 8: 47,052,849 (GRCm39) D154G probably damaging Het
Ptchd4 A C 17: 42,814,307 (GRCm39) H736P probably damaging Het
Rab11fip1 A G 8: 27,642,253 (GRCm39) S849P probably damaging Het
Rap1gap T A 4: 137,446,662 (GRCm39) D405E probably damaging Het
Rbm26 T C 14: 105,369,374 (GRCm39) T686A probably benign Het
Resf1 T C 6: 149,227,739 (GRCm39) Y262H probably damaging Het
Rint1 A G 5: 24,021,930 (GRCm39) probably benign Het
Rnasek G T 11: 70,129,266 (GRCm39) Y62* probably null Het
Rnf17 T G 14: 56,719,541 (GRCm39) N930K possibly damaging Het
Sap130 A G 18: 31,813,734 (GRCm39) probably benign Het
Sectm1b T A 11: 120,946,611 (GRCm39) I95F probably damaging Het
Sema4f A T 6: 82,916,447 (GRCm39) I53N possibly damaging Het
Shld1 T C 2: 132,592,559 (GRCm39) V202A probably benign Het
Siglec1 T C 2: 130,927,396 (GRCm39) T137A probably damaging Het
Six5 A C 7: 18,830,947 (GRCm39) probably null Het
Slc22a30 A T 19: 8,322,721 (GRCm39) I345N probably benign Het
Slc25a27 A T 17: 43,954,518 (GRCm39) M316K probably benign Het
Slc2a8 A T 2: 32,870,116 (GRCm39) probably benign Het
Snx1 G A 9: 66,008,608 (GRCm39) probably benign Het
Spata20 T C 11: 94,372,472 (GRCm39) D633G probably benign Het
Spock1 C T 13: 57,583,922 (GRCm39) probably null Het
Sra1 A T 18: 36,808,759 (GRCm39) Y291* probably null Het
Sspo C A 6: 48,470,120 (GRCm39) P4520T probably damaging Het
Stat4 A G 1: 52,051,016 (GRCm39) N25S probably benign Het
Tbx18 A T 9: 87,597,569 (GRCm39) probably benign Het
Tep1 T A 14: 51,084,444 (GRCm39) I187F probably damaging Het
Tfap2b A T 1: 19,304,347 (GRCm39) I368F probably damaging Het
Tmtc1 A T 6: 148,148,335 (GRCm39) L711Q probably damaging Het
Tmx3 T A 18: 90,556,613 (GRCm39) probably benign Het
Tnc G T 4: 63,888,657 (GRCm39) T1803K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tpgs1 C T 10: 79,511,700 (GRCm39) P281S probably benign Het
Trim45 A G 3: 100,837,160 (GRCm39) R499G probably benign Het
Tulp3 A T 6: 128,302,921 (GRCm39) Y299* probably null Het
Ube4a A T 9: 44,857,476 (GRCm39) probably benign Het
Ubr3 T G 2: 69,781,749 (GRCm39) S642R probably damaging Het
Vcpip1 A T 1: 9,817,431 (GRCm39) Y317* probably null Het
Vmn1r115 G A 7: 20,578,327 (GRCm39) T195I probably benign Het
Vmn1r226 G A 17: 20,907,839 (GRCm39) V24I probably benign Het
Wdr41 C T 13: 95,153,914 (GRCm39) A321V probably damaging Het
Wfdc5 T C 2: 164,020,755 (GRCm39) N44D probably benign Het
Wnt7b C A 15: 85,443,103 (GRCm39) probably null Het
Zfp108 T C 7: 23,961,208 (GRCm39) S600P possibly damaging Het
Zfp267 A G 3: 36,219,303 (GRCm39) H442R possibly damaging Het
Zfp385b A G 2: 77,246,072 (GRCm39) probably null Het
Zfp395 T C 14: 65,623,929 (GRCm39) S133P probably benign Het
Zfp407 T A 18: 84,576,836 (GRCm39) M1426L probably damaging Het
Zfp641 T G 15: 98,187,008 (GRCm39) N191T possibly damaging Het
Zfp687 T C 3: 94,918,864 (GRCm39) S303G probably damaging Het
Zfp759 T A 13: 67,286,877 (GRCm39) F143I possibly damaging Het
Zgrf1 G C 3: 127,409,095 (GRCm39) E1690Q probably damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 99,970,691 (GRCm39) missense probably benign 0.00
IGL01143:Spag17 APN 3 99,846,614 (GRCm39) missense probably benign 0.00
IGL01329:Spag17 APN 3 100,002,865 (GRCm39) missense probably benign 0.16
IGL01393:Spag17 APN 3 99,934,926 (GRCm39) missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100,016,824 (GRCm39) missense possibly damaging 0.65
IGL01705:Spag17 APN 3 99,930,046 (GRCm39) missense probably benign 0.01
IGL01928:Spag17 APN 3 99,847,390 (GRCm39) splice site probably benign
IGL01981:Spag17 APN 3 99,966,149 (GRCm39) missense probably benign 0.03
IGL02435:Spag17 APN 3 99,889,760 (GRCm39) missense possibly damaging 0.53
IGL02452:Spag17 APN 3 99,934,707 (GRCm39) missense probably benign 0.00
IGL02465:Spag17 APN 3 99,983,187 (GRCm39) missense probably damaging 0.96
IGL02615:Spag17 APN 3 99,979,401 (GRCm39) missense probably benign 0.09
IGL02751:Spag17 APN 3 99,918,110 (GRCm39) nonsense probably null
IGL02803:Spag17 APN 3 100,016,713 (GRCm39) missense probably benign
IGL02898:Spag17 APN 3 100,008,702 (GRCm39) missense probably benign 0.00
IGL03037:Spag17 APN 3 99,979,486 (GRCm39) splice site probably null
IGL03068:Spag17 APN 3 99,987,521 (GRCm39) missense probably benign 0.35
IGL03131:Spag17 APN 3 99,918,075 (GRCm39) missense possibly damaging 0.85
IGL03224:Spag17 APN 3 99,918,156 (GRCm39) missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 99,963,568 (GRCm39) small insertion probably benign
FR4342:Spag17 UTSW 3 99,963,565 (GRCm39) small insertion probably benign
FR4548:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,574 (GRCm39) small insertion probably benign
FR4589:Spag17 UTSW 3 99,963,561 (GRCm39) small insertion probably benign
FR4737:Spag17 UTSW 3 99,963,573 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,571 (GRCm39) small insertion probably benign
FR4976:Spag17 UTSW 3 99,963,570 (GRCm39) small insertion probably benign
N/A:Spag17 UTSW 3 99,889,570 (GRCm39) splice site probably benign
PIT4504001:Spag17 UTSW 3 100,010,426 (GRCm39) critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 99,920,527 (GRCm39) missense possibly damaging 0.53
R0107:Spag17 UTSW 3 99,958,103 (GRCm39) missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100,014,143 (GRCm39) missense probably benign 0.08
R0321:Spag17 UTSW 3 100,008,719 (GRCm39) missense probably damaging 0.99
R0375:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R0417:Spag17 UTSW 3 99,972,870 (GRCm39) missense probably benign 0.11
R0490:Spag17 UTSW 3 99,889,727 (GRCm39) missense probably damaging 0.97
R0537:Spag17 UTSW 3 100,032,618 (GRCm39) missense probably damaging 0.98
R0714:Spag17 UTSW 3 99,987,472 (GRCm39) missense probably damaging 0.97
R0844:Spag17 UTSW 3 99,912,101 (GRCm39) missense probably benign
R0919:Spag17 UTSW 3 99,979,259 (GRCm39) splice site probably benign
R0926:Spag17 UTSW 3 99,979,432 (GRCm39) missense probably benign
R1037:Spag17 UTSW 3 100,010,433 (GRCm39) missense probably benign 0.01
R1075:Spag17 UTSW 3 100,000,992 (GRCm39) missense probably damaging 0.99
R1109:Spag17 UTSW 3 99,934,667 (GRCm39) missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100,002,954 (GRCm39) missense probably benign 0.01
R1221:Spag17 UTSW 3 99,889,584 (GRCm39) missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99,846,679 (GRCm39) missense possibly damaging 0.73
R1586:Spag17 UTSW 3 99,929,068 (GRCm39) missense possibly damaging 0.53
R1768:Spag17 UTSW 3 99,934,668 (GRCm39) missense possibly damaging 0.53
R1782:Spag17 UTSW 3 99,918,070 (GRCm39) missense probably benign 0.02
R1789:Spag17 UTSW 3 99,846,672 (GRCm39) missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99,847,298 (GRCm39) missense probably benign
R2065:Spag17 UTSW 3 99,920,524 (GRCm39) missense probably benign 0.03
R2118:Spag17 UTSW 3 99,956,556 (GRCm39) missense possibly damaging 0.72
R2265:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2266:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2267:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2268:Spag17 UTSW 3 99,969,182 (GRCm39) splice site probably null
R2271:Spag17 UTSW 3 100,014,113 (GRCm39) missense probably damaging 1.00
R2389:Spag17 UTSW 3 100,014,153 (GRCm39) missense probably benign 0.27
R2420:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2422:Spag17 UTSW 3 99,934,935 (GRCm39) missense probably benign
R2423:Spag17 UTSW 3 100,010,772 (GRCm39) missense probably benign
R3407:Spag17 UTSW 3 99,992,615 (GRCm39) missense probably benign 0.09
R3801:Spag17 UTSW 3 99,961,169 (GRCm39) missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100,014,075 (GRCm39) missense probably damaging 1.00
R4021:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4022:Spag17 UTSW 3 99,956,546 (GRCm39) missense probably benign 0.00
R4408:Spag17 UTSW 3 100,010,694 (GRCm39) missense probably benign
R4468:Spag17 UTSW 3 99,992,682 (GRCm39) missense probably damaging 0.98
R4540:Spag17 UTSW 3 99,995,697 (GRCm39) missense probably damaging 1.00
R4621:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4622:Spag17 UTSW 3 100,010,559 (GRCm39) missense probably benign 0.08
R4756:Spag17 UTSW 3 100,010,701 (GRCm39) missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99,891,795 (GRCm39) missense possibly damaging 0.70
R4855:Spag17 UTSW 3 99,970,649 (GRCm39) missense probably benign 0.02
R4887:Spag17 UTSW 3 99,958,147 (GRCm39) missense probably damaging 1.00
R4962:Spag17 UTSW 3 99,934,939 (GRCm39) missense probably benign
R5030:Spag17 UTSW 3 99,992,657 (GRCm39) nonsense probably null
R5042:Spag17 UTSW 3 99,979,465 (GRCm39) missense probably damaging 1.00
R5074:Spag17 UTSW 3 99,987,434 (GRCm39) missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100,008,704 (GRCm39) missense probably benign 0.16
R5200:Spag17 UTSW 3 99,970,787 (GRCm39) nonsense probably null
R5267:Spag17 UTSW 3 99,969,264 (GRCm39) missense probably damaging 0.98
R5360:Spag17 UTSW 3 100,016,726 (GRCm39) missense probably benign 0.00
R5444:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5498:Spag17 UTSW 3 100,010,661 (GRCm39) missense possibly damaging 0.83
R5503:Spag17 UTSW 3 99,934,560 (GRCm39) missense possibly damaging 0.72
R5540:Spag17 UTSW 3 99,963,588 (GRCm39) missense possibly damaging 0.91
R5547:Spag17 UTSW 3 99,963,468 (GRCm39) missense probably benign 0.06
R5575:Spag17 UTSW 3 99,961,138 (GRCm39) missense possibly damaging 0.85
R5629:Spag17 UTSW 3 99,987,435 (GRCm39) missense probably benign 0.33
R5639:Spag17 UTSW 3 99,963,482 (GRCm39) missense probably damaging 1.00
R5842:Spag17 UTSW 3 99,846,566 (GRCm39) missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100,003,107 (GRCm39) nonsense probably null
R6082:Spag17 UTSW 3 100,031,501 (GRCm39) missense possibly damaging 0.46
R6228:Spag17 UTSW 3 99,929,918 (GRCm39) missense probably benign 0.33
R6254:Spag17 UTSW 3 99,972,901 (GRCm39) missense probably benign 0.03
R6321:Spag17 UTSW 3 99,995,743 (GRCm39) missense probably benign 0.05
R6446:Spag17 UTSW 3 100,010,448 (GRCm39) missense probably benign
R6687:Spag17 UTSW 3 100,000,266 (GRCm39) missense probably benign 0.07
R6853:Spag17 UTSW 3 99,920,551 (GRCm39) missense possibly damaging 0.86
R6946:Spag17 UTSW 3 99,911,999 (GRCm39) missense possibly damaging 0.53
R6953:Spag17 UTSW 3 99,942,291 (GRCm39) missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99,891,925 (GRCm39) missense probably benign 0.00
R7084:Spag17 UTSW 3 99,846,586 (GRCm39) missense probably benign 0.18
R7126:Spag17 UTSW 3 100,008,751 (GRCm39) missense probably benign 0.00
R7144:Spag17 UTSW 3 99,934,717 (GRCm39) splice site probably null
R7198:Spag17 UTSW 3 100,002,888 (GRCm39) missense probably benign 0.02
R7318:Spag17 UTSW 3 99,847,299 (GRCm39) missense probably benign 0.00
R7403:Spag17 UTSW 3 99,846,691 (GRCm39) missense possibly damaging 0.53
R7409:Spag17 UTSW 3 99,934,547 (GRCm39) missense possibly damaging 0.73
R7409:Spag17 UTSW 3 99,941,475 (GRCm39) missense probably benign 0.00
R7537:Spag17 UTSW 3 99,846,563 (GRCm39) missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100,002,911 (GRCm39) nonsense probably null
R7772:Spag17 UTSW 3 99,987,434 (GRCm39) missense probably damaging 0.98
R7842:Spag17 UTSW 3 99,961,174 (GRCm39) missense probably benign 0.18
R7963:Spag17 UTSW 3 99,929,954 (GRCm39) missense probably benign 0.02
R8168:Spag17 UTSW 3 99,942,300 (GRCm39) missense possibly damaging 0.96
R8291:Spag17 UTSW 3 99,968,166 (GRCm39) missense probably benign
R8347:Spag17 UTSW 3 99,934,957 (GRCm39) missense probably benign
R8383:Spag17 UTSW 3 99,992,708 (GRCm39) missense probably damaging 0.98
R8474:Spag17 UTSW 3 99,934,586 (GRCm39) missense probably benign 0.00
R8528:Spag17 UTSW 3 100,031,501 (GRCm39) missense possibly damaging 0.46
R8804:Spag17 UTSW 3 99,874,506 (GRCm39) missense probably benign
R8809:Spag17 UTSW 3 99,889,738 (GRCm39) missense probably benign 0.33
R8818:Spag17 UTSW 3 99,920,543 (GRCm39) missense probably benign 0.02
R8830:Spag17 UTSW 3 100,032,751 (GRCm39) missense possibly damaging 0.77
R8890:Spag17 UTSW 3 99,911,994 (GRCm39) missense possibly damaging 0.73
R9008:Spag17 UTSW 3 99,934,942 (GRCm39) missense possibly damaging 0.73
R9095:Spag17 UTSW 3 99,912,092 (GRCm39) missense possibly damaging 0.86
R9143:Spag17 UTSW 3 99,934,906 (GRCm39) missense probably benign
R9182:Spag17 UTSW 3 99,966,158 (GRCm39) missense possibly damaging 0.92
R9211:Spag17 UTSW 3 100,032,614 (GRCm39) critical splice acceptor site probably benign
R9344:Spag17 UTSW 3 100,010,793 (GRCm39) missense probably benign 0.01
R9354:Spag17 UTSW 3 99,934,905 (GRCm39) missense probably benign
R9527:Spag17 UTSW 3 99,970,777 (GRCm39) missense probably damaging 1.00
R9658:Spag17 UTSW 3 99,934,932 (GRCm39) missense possibly damaging 0.93
R9738:Spag17 UTSW 3 99,934,526 (GRCm39) missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100,008,767 (GRCm39) missense probably benign 0.31
Z1088:Spag17 UTSW 3 100,002,946 (GRCm39) missense probably benign 0.09
Z1176:Spag17 UTSW 3 99,920,309 (GRCm39) missense probably benign 0.18
Z1177:Spag17 UTSW 3 99,995,715 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATAGTCATTGTACCCGAGCAC -3'
(R):5'- CAAAATGGCAGTCTTACAAGAAGCAGC -3'

Sequencing Primer
(F):5'- GTACCCGAGCACGTTTTTTATG -3'
(R):5'- ctctctctctctctctctccc -3'
Posted On 2013-05-23