Incidental Mutation 'R4918:Scn3a'
ID378366
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission 042520-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4918 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65461455 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1649 (N1649S)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably damaging
Transcript: ENSMUST00000066432
AA Change: N1649S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: N1649S

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100069
AA Change: N1649S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: N1649S

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Meta Mutation Damage Score 0.4015 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (116/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T G 17: 28,908,363 Q224P probably benign Het
Abca6 T A 11: 110,180,551 I1492F probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bnip1 C T 17: 26,783,551 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cntnap2 T C 6: 46,530,035 probably benign Het
Col9a1 T C 1: 24,237,258 I749T possibly damaging Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dhx40 G T 11: 86,804,391 H98N possibly damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpysl5 T G 5: 30,792,268 F461V probably damaging Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Esyt2 T C 12: 116,324,140 V226A probably benign Het
Fan1 A T 7: 64,373,538 probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fsip2 G A 2: 82,993,770 V6616I possibly damaging Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Golga4 C A 9: 118,558,145 S1445Y probably damaging Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ifi206 T A 1: 173,482,044 T129S possibly damaging Het
Jakmip1 G A 5: 37,091,275 R93Q probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt5 A T 15: 101,710,307 Y340N probably damaging Het
Krt90 T A 15: 101,562,479 H116L possibly damaging Het
Large2 A G 2: 92,366,107 probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mrps28 A G 3: 8,882,554 probably benign Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nckap1l A G 15: 103,483,613 N825S probably benign Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr353 A G 2: 36,890,332 I172T probably damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Olfr988 C T 2: 85,353,288 V213I probably benign Het
Pcdh20 A C 14: 88,467,668 L732R probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prpf18 T C 2: 4,637,170 D186G probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rbp3 T C 14: 33,955,411 Y439H probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Sulf1 A G 1: 12,818,496 D335G probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Thsd7a A C 6: 12,327,559 I1438S probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Trav6d-4 T C 14: 52,753,783 F95S probably damaging Het
Ttn T C 2: 76,759,254 T21219A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r69 T A 7: 85,406,759 M724L probably benign Het
Zeb2 A G 2: 44,996,882 I706T probably damaging Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5730:Scn3a UTSW 2 65495260 missense probably benign 0.00
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCACCACAACCAGGAAGG -3'
(R):5'- CGAATCCTACGCCTGATCAAAG -3'

Sequencing Primer
(F):5'- TGTTCACCACAACCAGGAAGGATATG -3'
(R):5'- CCTGATCAAAGGCGCCAAGG -3'
Posted On2016-04-15