Incidental Mutation 'R4918:Ago4'
ID 378388
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Name argonaute RISC catalytic subunit 4
Synonyms Eif2c4, 5730550L01Rik, argonaute 4
MMRRC Submission 042520-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R4918 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126383334-126427265 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 126400635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 693 (C693G)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
AlphaFold Q8CJF8
Predicted Effect probably damaging
Transcript: ENSMUST00000084289
AA Change: C693G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: C693G

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Meta Mutation Damage Score 0.9258 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (116/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,071,377 (GRCm39) I1492F probably damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Arfgef3 T A 10: 18,492,638 (GRCm39) I1258F probably damaging Het
Arhgef40 A G 14: 52,227,556 (GRCm39) E434G probably damaging Het
Baz2b T A 2: 59,744,387 (GRCm39) T1373S possibly damaging Het
Bcas1 T C 2: 170,220,806 (GRCm39) D324G probably damaging Het
Bdp1 A T 13: 100,191,713 (GRCm39) V1422E probably damaging Het
Bfsp1 C T 2: 143,669,391 (GRCm39) R396Q probably benign Het
Bnip1 C T 17: 27,002,525 (GRCm39) probably benign Het
Bnip5 T G 17: 29,127,337 (GRCm39) Q224P probably benign Het
Bpifb9b T A 2: 154,156,026 (GRCm39) probably null Het
Casp8 T C 1: 58,866,377 (GRCm39) F126S probably damaging Het
Cdh26 T C 2: 178,091,614 (GRCm39) S58P probably benign Het
Cntnap2 T C 6: 46,506,969 (GRCm39) probably benign Het
Col9a1 T C 1: 24,276,339 (GRCm39) I749T possibly damaging Het
Ddx50 A T 10: 62,463,450 (GRCm39) C414* probably null Het
Defb42 A G 14: 63,285,790 (GRCm39) I57V probably benign Het
Dennd5a A G 7: 109,500,296 (GRCm39) F943S probably damaging Het
Dhx40 G T 11: 86,695,217 (GRCm39) H98N possibly damaging Het
Disp2 A T 2: 118,620,935 (GRCm39) S556C probably damaging Het
Dpysl5 T G 5: 30,949,612 (GRCm39) F461V probably damaging Het
Efcab11 T C 12: 99,685,321 (GRCm39) D151G probably damaging Het
Egfem1 T C 3: 29,206,042 (GRCm39) V93A probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Esyt2 T C 12: 116,287,760 (GRCm39) V226A probably benign Het
Fan1 A T 7: 64,023,286 (GRCm39) probably benign Het
Fasn T G 11: 120,707,472 (GRCm39) N799T probably benign Het
Fbxo3 T G 2: 103,885,311 (GRCm39) N388K probably damaging Het
Fer1l4 T C 2: 155,873,220 (GRCm39) K1287E probably benign Het
Fn1 A T 1: 71,634,968 (GRCm39) probably null Het
Fsip2 G A 2: 82,824,114 (GRCm39) V6616I possibly damaging Het
Fut8 G T 12: 77,521,818 (GRCm39) A486S probably damaging Het
Glp2r G T 11: 67,648,419 (GRCm39) Y94* probably null Het
Gm10764 A G 10: 87,126,579 (GRCm39) noncoding transcript Het
Gm6788 C T 19: 28,740,664 (GRCm39) noncoding transcript Het
Gm8122 T C 14: 43,091,573 (GRCm39) N65S unknown Het
Golga4 C A 9: 118,387,213 (GRCm39) S1445Y probably damaging Het
Gsdmd A G 15: 75,736,241 (GRCm39) I123M probably benign Het
Hsf4 A G 8: 105,999,367 (GRCm39) E235G probably benign Het
Ifi206 T A 1: 173,309,610 (GRCm39) T129S possibly damaging Het
Jakmip1 G A 5: 37,248,619 (GRCm39) R93Q probably damaging Het
Kcnj1 T A 9: 32,308,056 (GRCm39) L160Q probably damaging Het
Kif1a T A 1: 93,002,700 (GRCm39) E233V probably benign Het
Krt5 A T 15: 101,618,742 (GRCm39) Y340N probably damaging Het
Krt90 T A 15: 101,470,914 (GRCm39) H116L possibly damaging Het
Large2 A G 2: 92,196,452 (GRCm39) probably benign Het
Marchf4 T G 1: 72,467,938 (GRCm39) S365R probably benign Het
Mei4 A G 9: 81,772,216 (GRCm39) T10A probably benign Het
Meis1 T C 11: 18,959,222 (GRCm39) probably benign Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mrps28 A G 3: 8,947,614 (GRCm39) probably benign Het
Ncdn G A 4: 126,643,731 (GRCm39) L364F possibly damaging Het
Nckap1l A G 15: 103,392,040 (GRCm39) N825S probably benign Het
Nfat5 T A 8: 108,051,284 (GRCm39) D47E probably damaging Het
Nfix T C 8: 85,498,458 (GRCm39) I172V probably benign Het
Nkx3-1 G A 14: 69,428,367 (GRCm39) G72S probably benign Het
Nsf G A 11: 103,801,185 (GRCm39) probably benign Het
Or1b1 A T 2: 36,995,170 (GRCm39) I164N possibly damaging Het
Or1n1b A G 2: 36,780,344 (GRCm39) I172T probably damaging Het
Or3a1b A T 11: 74,012,705 (GRCm39) I197F probably benign Het
Or51g2 A T 7: 102,622,614 (GRCm39) I195N possibly damaging Het
Or5ak20 C T 2: 85,183,632 (GRCm39) V213I probably benign Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Or5bw2 C T 7: 6,573,643 (GRCm39) L218F possibly damaging Het
Or9g10 T C 2: 85,584,465 (GRCm39) probably benign Het
Pcdh20 A C 14: 88,705,104 (GRCm39) L732R probably damaging Het
Pgbd5 C A 8: 125,097,305 (GRCm39) K408N probably benign Het
Pip4k2c T C 10: 127,035,196 (GRCm39) T391A possibly damaging Het
Ppm1k T A 6: 57,487,762 (GRCm39) N354Y probably damaging Het
Prpf18 T C 2: 4,641,981 (GRCm39) D186G probably benign Het
Rab3gap1 T A 1: 127,816,914 (GRCm39) W58R possibly damaging Het
Rbp3 T C 14: 33,677,368 (GRCm39) Y439H probably damaging Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Rsf1 T C 7: 97,311,612 (GRCm39) S781P probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryr2 A G 13: 11,609,872 (GRCm39) V753A probably damaging Het
Schip1 A T 3: 68,315,818 (GRCm39) probably benign Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Scn3a T C 2: 65,291,799 (GRCm39) N1649S probably damaging Het
Sh3rf3 A T 10: 58,842,925 (GRCm39) D297V probably damaging Het
Slc20a2 C T 8: 23,051,020 (GRCm39) S351L probably damaging Het
Slc35e2 C A 4: 155,700,693 (GRCm39) P272Q probably damaging Het
Slc4a1 A G 11: 102,243,279 (GRCm39) V784A probably damaging Het
Slco1b2 G A 6: 141,615,096 (GRCm39) V334I probably benign Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Spag6 A T 2: 18,750,360 (GRCm39) I469F probably benign Het
Spsb2 A C 6: 124,786,711 (GRCm39) E148A probably benign Het
Sulf1 A G 1: 12,888,720 (GRCm39) D335G probably damaging Het
Tchhl1 A G 3: 93,377,623 (GRCm39) D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 (GRCm38) I83V probably damaging Het
Thsd7a A C 6: 12,327,558 (GRCm39) I1438S probably damaging Het
Tm4sf1 C T 3: 57,200,448 (GRCm39) G85S probably damaging Het
Tmem63a T A 1: 180,794,086 (GRCm39) I541N probably benign Het
Trav6d-4 T C 14: 52,991,240 (GRCm39) F95S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T C 2: 76,589,598 (GRCm39) T21219A probably damaging Het
Unc80 T C 1: 66,685,709 (GRCm39) Y2278H possibly damaging Het
Usp8 A T 2: 126,562,060 (GRCm39) K85* probably null Het
Vmn2r69 T A 7: 85,055,967 (GRCm39) M724L probably benign Het
Zeb2 A G 2: 44,886,894 (GRCm39) I706T probably damaging Het
Zfp512 T C 5: 31,634,209 (GRCm39) S407P probably damaging Het
Zfp791 T A 8: 85,837,580 (GRCm39) I95L probably benign Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126,410,926 (GRCm39) missense probably benign 0.01
IGL00965:Ago4 APN 4 126,387,107 (GRCm39) missense probably benign 0.01
IGL01306:Ago4 APN 4 126,409,677 (GRCm39) splice site probably null
IGL01943:Ago4 APN 4 126,410,988 (GRCm39) missense probably damaging 1.00
IGL02079:Ago4 APN 4 126,410,877 (GRCm39) missense probably damaging 0.99
IGL02117:Ago4 APN 4 126,410,645 (GRCm39) missense probably benign 0.00
IGL02229:Ago4 APN 4 126,405,325 (GRCm39) missense probably benign 0.34
IGL02503:Ago4 APN 4 126,390,598 (GRCm39) nonsense probably null
IGL02504:Ago4 APN 4 126,411,232 (GRCm39) missense probably benign 0.00
IGL02975:Ago4 APN 4 126,406,312 (GRCm39) critical splice donor site probably null
BB010:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
BB020:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
IGL02837:Ago4 UTSW 4 126,391,093 (GRCm39) missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126,410,976 (GRCm39) missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126,410,725 (GRCm39) missense probably benign 0.24
R0480:Ago4 UTSW 4 126,419,870 (GRCm39) missense probably benign 0.00
R0533:Ago4 UTSW 4 126,410,653 (GRCm39) missense probably benign 0.00
R1014:Ago4 UTSW 4 126,400,578 (GRCm39) missense probably damaging 1.00
R1350:Ago4 UTSW 4 126,400,925 (GRCm39) missense probably benign 0.04
R1547:Ago4 UTSW 4 126,405,206 (GRCm39) missense probably benign 0.01
R1894:Ago4 UTSW 4 126,406,393 (GRCm39) missense probably benign 0.11
R1900:Ago4 UTSW 4 126,410,729 (GRCm39) missense probably benign 0.00
R2510:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R2511:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R4063:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4064:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4120:Ago4 UTSW 4 126,390,600 (GRCm39) missense probably damaging 1.00
R4916:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4917:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4941:Ago4 UTSW 4 126,419,847 (GRCm39) missense probably benign 0.00
R5169:Ago4 UTSW 4 126,405,520 (GRCm39) missense probably benign 0.06
R5262:Ago4 UTSW 4 126,390,557 (GRCm39) missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126,411,349 (GRCm39) missense probably benign
R5757:Ago4 UTSW 4 126,419,877 (GRCm39) missense probably damaging 1.00
R6244:Ago4 UTSW 4 126,405,280 (GRCm39) missense possibly damaging 0.67
R6256:Ago4 UTSW 4 126,414,019 (GRCm39) missense probably damaging 1.00
R6389:Ago4 UTSW 4 126,401,037 (GRCm39) missense probably damaging 1.00
R6545:Ago4 UTSW 4 126,405,811 (GRCm39) missense probably benign 0.10
R7378:Ago4 UTSW 4 126,405,257 (GRCm39) missense probably benign
R7804:Ago4 UTSW 4 126,406,423 (GRCm39) missense probably benign 0.02
R7890:Ago4 UTSW 4 126,419,869 (GRCm39) missense probably benign 0.00
R7933:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
R8824:Ago4 UTSW 4 126,400,977 (GRCm39) missense probably benign 0.04
R8852:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R8860:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R9023:Ago4 UTSW 4 126,400,596 (GRCm39) missense probably damaging 1.00
R9127:Ago4 UTSW 4 126,400,904 (GRCm39) missense probably damaging 1.00
R9138:Ago4 UTSW 4 126,414,073 (GRCm39) nonsense probably null
R9447:Ago4 UTSW 4 126,402,151 (GRCm39) missense probably benign 0.13
X0062:Ago4 UTSW 4 126,409,734 (GRCm39) missense probably benign 0.00
X0064:Ago4 UTSW 4 126,411,275 (GRCm39) missense possibly damaging 0.87
Z1176:Ago4 UTSW 4 126,413,983 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAGACACAGGTGTTTTAGGGATAC -3'
(R):5'- CATCATCTACTACCGCGGAG -3'

Sequencing Primer
(F):5'- GGGATACTGTAAACATCTCCTCAAAG -3'
(R):5'- TATCCGAGGGACAGATGAAGC -3'
Posted On 2016-04-15