Mutagenetix > Incidental Mutation

Incidental Mutation 'R4918:Golga4'

378416

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

042520-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4918 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 118558145 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 1445 (S1445Y)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084820
AA Change: S1445Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1445Y

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000211840
AA Change: S455Y

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212913

Meta Mutation Damage Score

0.2356

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

99% (116/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	G	17: 28,908,363	Q224P	probably benign	Het
Abca6	T	A	11: 110,180,551	I1492F	probably damaging	Het
Ago4	A	C	4: 126,506,842	C693G	probably damaging	Het
Apobec2	T	C	17: 48,423,125	E171G	probably benign	Het
Arfgef3	T	A	10: 18,616,890	I1258F	probably damaging	Het
Arhgef40	A	G	14: 51,990,099	E434G	probably damaging	Het
Baz2b	T	A	2: 59,914,043	T1373S	possibly damaging	Het
Bcas1	T	C	2: 170,378,886	D324G	probably damaging	Het
Bdp1	A	T	13: 100,055,205	V1422E	probably damaging	Het
Bfsp1	C	T	2: 143,827,471	R396Q	probably benign	Het
Bnip1	C	T	17: 26,783,551		probably benign	Het
Bpifb9b	T	A	2: 154,314,106		probably null	Het
Casp8	T	C	1: 58,827,218	F126S	probably damaging	Het
Cdh26	T	C	2: 178,449,821	S58P	probably benign	Het
Cntnap2	T	C	6: 46,530,035		probably benign	Het
Col9a1	T	C	1: 24,237,258	I749T	possibly damaging	Het
Ddx50	A	T	10: 62,627,671	C414*	probably null	Het
Defb42	A	G	14: 63,048,341	I57V	probably benign	Het
Dennd5a	A	G	7: 109,901,089	F943S	probably damaging	Het
Dhx40	G	T	11: 86,804,391	H98N	possibly damaging	Het
Disp2	A	T	2: 118,790,454	S556C	probably damaging	Het
Dpysl5	T	G	5: 30,792,268	F461V	probably damaging	Het
Efcab11	T	C	12: 99,719,062	D151G	probably damaging	Het
Egfem1	T	C	3: 29,151,893	V93A	probably damaging	Het
Ehbp1	T	C	11: 22,146,592	D299G	probably benign	Het
Esyt2	T	C	12: 116,324,140	V226A	probably benign	Het
Fan1	A	T	7: 64,373,538		probably benign	Het
Fasn	T	G	11: 120,816,646	N799T	probably benign	Het
Fbxo3	T	G	2: 104,054,966	N388K	probably damaging	Het
Fer1l4	T	C	2: 156,031,300	K1287E	probably benign	Het
Fn1	A	T	1: 71,595,809		probably null	Het
Fsip2	G	A	2: 82,993,770	V6616I	possibly damaging	Het
Fut8	G	T	12: 77,475,044	A486S	probably damaging	Het
Glp2r	G	T	11: 67,757,593	Y94*	probably null	Het
Gm10764	A	G	10: 87,290,717		noncoding transcript	Het
Gm6788	C	T	19: 28,763,264		noncoding transcript	Het
Gm8122	T	C	14: 43,234,116	N65S	unknown	Het
Gsdmd	A	G	15: 75,864,392	I123M	probably benign	Het
Hsf4	A	G	8: 105,272,735	E235G	probably benign	Het
Ifi206	T	A	1: 173,482,044	T129S	possibly damaging	Het
Jakmip1	G	A	5: 37,091,275	R93Q	probably damaging	Het
Kcnj1	T	A	9: 32,396,760	L160Q	probably damaging	Het
Kif1a	T	A	1: 93,074,978	E233V	probably benign	Het
Krt5	A	T	15: 101,710,307	Y340N	probably damaging	Het
Krt90	T	A	15: 101,562,479	H116L	possibly damaging	Het
Large2	A	G	2: 92,366,107		probably benign	Het
March4	T	G	1: 72,428,779	S365R	probably benign	Het
Mei4	A	G	9: 81,890,163	T10A	probably benign	Het
Meis1	T	C	11: 19,009,222		probably benign	Het
Mllt1	T	C	17: 56,899,813	T344A	probably benign	Het
Mrps28	A	G	3: 8,882,554		probably benign	Het
Ncdn	G	A	4: 126,749,938	L364F	possibly damaging	Het
Nckap1l	A	G	15: 103,483,613	N825S	probably benign	Het
Nfat5	T	A	8: 107,324,652	D47E	probably damaging	Het
Nfix	T	C	8: 84,771,829	I172V	probably benign	Het
Nkx3-1	G	A	14: 69,190,918	G72S	probably benign	Het
Nsf	G	A	11: 103,910,359		probably benign	Het
Olfr1010	T	C	2: 85,754,121		probably benign	Het
Olfr1350	C	T	7: 6,570,644	L218F	possibly damaging	Het
Olfr1459	T	A	19: 13,145,991	I223L	possibly damaging	Het
Olfr353	A	G	2: 36,890,332	I172T	probably damaging	Het
Olfr362	A	T	2: 37,105,158	I164N	possibly damaging	Het
Olfr401	A	T	11: 74,121,879	I197F	probably benign	Het
Olfr577	A	T	7: 102,973,407	I195N	possibly damaging	Het
Olfr988	C	T	2: 85,353,288	V213I	probably benign	Het
Pcdh20	A	C	14: 88,467,668	L732R	probably damaging	Het
Pgbd5	C	A	8: 124,370,566	K408N	probably benign	Het
Pip4k2c	T	C	10: 127,199,327	T391A	possibly damaging	Het
Ppm1k	T	A	6: 57,510,777	N354Y	probably damaging	Het
Prpf18	T	C	2: 4,637,170	D186G	probably benign	Het
Rab3gap1	T	A	1: 127,889,177	W58R	possibly damaging	Het
Rbp3	T	C	14: 33,955,411	Y439H	probably damaging	Het
Rere	T	A	4: 150,619,144	W1528R	probably damaging	Het
Rsf1	T	C	7: 97,662,405	S781P	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr2	A	G	13: 11,594,986	V753A	probably damaging	Het
Schip1	A	T	3: 68,408,485		probably benign	Het
Scin	T	A	12: 40,069,374	I552F	possibly damaging	Het
Scn3a	T	C	2: 65,461,455	N1649S	probably damaging	Het
Sh3rf3	A	T	10: 59,007,103	D297V	probably damaging	Het
Slc20a2	C	T	8: 22,561,004	S351L	probably damaging	Het
Slc35e2	C	A	4: 155,616,236	P272Q	probably damaging	Het
Slc4a1	A	G	11: 102,352,453	V784A	probably damaging	Het
Slco1b2	G	A	6: 141,669,370	V334I	probably benign	Het
Slf2	T	G	19: 44,971,661	D1022E	probably damaging	Het
Spag6	A	T	2: 18,745,549	I469F	probably benign	Het
Spsb2	A	C	6: 124,809,748	E148A	probably benign	Het
Sulf1	A	G	1: 12,818,496	D335G	probably damaging	Het
Tchhl1	A	G	3: 93,470,316	D109G	possibly damaging	Het
Thoc7	T	C	14: 13,953,154	I83V	probably damaging	Het
Thsd7a	A	C	6: 12,327,559	I1438S	probably damaging	Het
Tm4sf1	C	T	3: 57,293,027	G85S	probably damaging	Het
Tmem63a	T	A	1: 180,966,521	I541N	probably benign	Het
Trav6d-4	T	C	14: 52,753,783	F95S	probably damaging	Het
Ttn	T	C	2: 76,759,254	T21219A	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc80	T	C	1: 66,646,550	Y2278H	possibly damaging	Het
Usp8	A	T	2: 126,720,140	K85*	probably null	Het
Vmn2r69	T	A	7: 85,406,759	M724L	probably benign	Het
Zeb2	A	G	2: 44,996,882	I706T	probably damaging	Het
Zfp512	T	C	5: 31,476,865	S407P	probably damaging	Het
Zfp791	T	A	8: 85,110,951	I95L	probably benign	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CTACTGAGAGAAGAGCTGTCGG -3'
(R):5'- ATTCTGCCGATCAAGGTCTTCC -3'

Sequencing Primer
(F):5'- TTGCCAGTCTTAGCAAGCAG -3'
(R):5'- GGTCTTCCTTCAGTAAACATATCTG -3'

Posted On

2016-04-15