Incidental Mutation 'R4918:Golga4'
ID 378416
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 042520-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4918 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 118387213 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Tyrosine at position 1445 (S1445Y)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000084820
AA Change: S1445Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1445Y

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211840
AA Change: S455Y
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212913
Meta Mutation Damage Score 0.2356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (116/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,071,377 (GRCm39) I1492F probably damaging Het
Ago4 A C 4: 126,400,635 (GRCm39) C693G probably damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Arfgef3 T A 10: 18,492,638 (GRCm39) I1258F probably damaging Het
Arhgef40 A G 14: 52,227,556 (GRCm39) E434G probably damaging Het
Baz2b T A 2: 59,744,387 (GRCm39) T1373S possibly damaging Het
Bcas1 T C 2: 170,220,806 (GRCm39) D324G probably damaging Het
Bdp1 A T 13: 100,191,713 (GRCm39) V1422E probably damaging Het
Bfsp1 C T 2: 143,669,391 (GRCm39) R396Q probably benign Het
Bnip1 C T 17: 27,002,525 (GRCm39) probably benign Het
Bnip5 T G 17: 29,127,337 (GRCm39) Q224P probably benign Het
Bpifb9b T A 2: 154,156,026 (GRCm39) probably null Het
Casp8 T C 1: 58,866,377 (GRCm39) F126S probably damaging Het
Cdh26 T C 2: 178,091,614 (GRCm39) S58P probably benign Het
Cntnap2 T C 6: 46,506,969 (GRCm39) probably benign Het
Col9a1 T C 1: 24,276,339 (GRCm39) I749T possibly damaging Het
Ddx50 A T 10: 62,463,450 (GRCm39) C414* probably null Het
Defb42 A G 14: 63,285,790 (GRCm39) I57V probably benign Het
Dennd5a A G 7: 109,500,296 (GRCm39) F943S probably damaging Het
Dhx40 G T 11: 86,695,217 (GRCm39) H98N possibly damaging Het
Disp2 A T 2: 118,620,935 (GRCm39) S556C probably damaging Het
Dpysl5 T G 5: 30,949,612 (GRCm39) F461V probably damaging Het
Efcab11 T C 12: 99,685,321 (GRCm39) D151G probably damaging Het
Egfem1 T C 3: 29,206,042 (GRCm39) V93A probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Esyt2 T C 12: 116,287,760 (GRCm39) V226A probably benign Het
Fan1 A T 7: 64,023,286 (GRCm39) probably benign Het
Fasn T G 11: 120,707,472 (GRCm39) N799T probably benign Het
Fbxo3 T G 2: 103,885,311 (GRCm39) N388K probably damaging Het
Fer1l4 T C 2: 155,873,220 (GRCm39) K1287E probably benign Het
Fn1 A T 1: 71,634,968 (GRCm39) probably null Het
Fsip2 G A 2: 82,824,114 (GRCm39) V6616I possibly damaging Het
Fut8 G T 12: 77,521,818 (GRCm39) A486S probably damaging Het
Glp2r G T 11: 67,648,419 (GRCm39) Y94* probably null Het
Gm10764 A G 10: 87,126,579 (GRCm39) noncoding transcript Het
Gm6788 C T 19: 28,740,664 (GRCm39) noncoding transcript Het
Gm8122 T C 14: 43,091,573 (GRCm39) N65S unknown Het
Gsdmd A G 15: 75,736,241 (GRCm39) I123M probably benign Het
Hsf4 A G 8: 105,999,367 (GRCm39) E235G probably benign Het
Ifi206 T A 1: 173,309,610 (GRCm39) T129S possibly damaging Het
Jakmip1 G A 5: 37,248,619 (GRCm39) R93Q probably damaging Het
Kcnj1 T A 9: 32,308,056 (GRCm39) L160Q probably damaging Het
Kif1a T A 1: 93,002,700 (GRCm39) E233V probably benign Het
Krt5 A T 15: 101,618,742 (GRCm39) Y340N probably damaging Het
Krt90 T A 15: 101,470,914 (GRCm39) H116L possibly damaging Het
Large2 A G 2: 92,196,452 (GRCm39) probably benign Het
Marchf4 T G 1: 72,467,938 (GRCm39) S365R probably benign Het
Mei4 A G 9: 81,772,216 (GRCm39) T10A probably benign Het
Meis1 T C 11: 18,959,222 (GRCm39) probably benign Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mrps28 A G 3: 8,947,614 (GRCm39) probably benign Het
Ncdn G A 4: 126,643,731 (GRCm39) L364F possibly damaging Het
Nckap1l A G 15: 103,392,040 (GRCm39) N825S probably benign Het
Nfat5 T A 8: 108,051,284 (GRCm39) D47E probably damaging Het
Nfix T C 8: 85,498,458 (GRCm39) I172V probably benign Het
Nkx3-1 G A 14: 69,428,367 (GRCm39) G72S probably benign Het
Nsf G A 11: 103,801,185 (GRCm39) probably benign Het
Or1b1 A T 2: 36,995,170 (GRCm39) I164N possibly damaging Het
Or1n1b A G 2: 36,780,344 (GRCm39) I172T probably damaging Het
Or3a1b A T 11: 74,012,705 (GRCm39) I197F probably benign Het
Or51g2 A T 7: 102,622,614 (GRCm39) I195N possibly damaging Het
Or5ak20 C T 2: 85,183,632 (GRCm39) V213I probably benign Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Or5bw2 C T 7: 6,573,643 (GRCm39) L218F possibly damaging Het
Or9g10 T C 2: 85,584,465 (GRCm39) probably benign Het
Pcdh20 A C 14: 88,705,104 (GRCm39) L732R probably damaging Het
Pgbd5 C A 8: 125,097,305 (GRCm39) K408N probably benign Het
Pip4k2c T C 10: 127,035,196 (GRCm39) T391A possibly damaging Het
Ppm1k T A 6: 57,487,762 (GRCm39) N354Y probably damaging Het
Prpf18 T C 2: 4,641,981 (GRCm39) D186G probably benign Het
Rab3gap1 T A 1: 127,816,914 (GRCm39) W58R possibly damaging Het
Rbp3 T C 14: 33,677,368 (GRCm39) Y439H probably damaging Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Rsf1 T C 7: 97,311,612 (GRCm39) S781P probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryr2 A G 13: 11,609,872 (GRCm39) V753A probably damaging Het
Schip1 A T 3: 68,315,818 (GRCm39) probably benign Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Scn3a T C 2: 65,291,799 (GRCm39) N1649S probably damaging Het
Sh3rf3 A T 10: 58,842,925 (GRCm39) D297V probably damaging Het
Slc20a2 C T 8: 23,051,020 (GRCm39) S351L probably damaging Het
Slc35e2 C A 4: 155,700,693 (GRCm39) P272Q probably damaging Het
Slc4a1 A G 11: 102,243,279 (GRCm39) V784A probably damaging Het
Slco1b2 G A 6: 141,615,096 (GRCm39) V334I probably benign Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Spag6 A T 2: 18,750,360 (GRCm39) I469F probably benign Het
Spsb2 A C 6: 124,786,711 (GRCm39) E148A probably benign Het
Sulf1 A G 1: 12,888,720 (GRCm39) D335G probably damaging Het
Tchhl1 A G 3: 93,377,623 (GRCm39) D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 (GRCm38) I83V probably damaging Het
Thsd7a A C 6: 12,327,558 (GRCm39) I1438S probably damaging Het
Tm4sf1 C T 3: 57,200,448 (GRCm39) G85S probably damaging Het
Tmem63a T A 1: 180,794,086 (GRCm39) I541N probably benign Het
Trav6d-4 T C 14: 52,991,240 (GRCm39) F95S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T C 2: 76,589,598 (GRCm39) T21219A probably damaging Het
Unc80 T C 1: 66,685,709 (GRCm39) Y2278H possibly damaging Het
Usp8 A T 2: 126,562,060 (GRCm39) K85* probably null Het
Vmn2r69 T A 7: 85,055,967 (GRCm39) M724L probably benign Het
Zeb2 A G 2: 44,886,894 (GRCm39) I706T probably damaging Het
Zfp512 T C 5: 31,634,209 (GRCm39) S407P probably damaging Het
Zfp791 T A 8: 85,837,580 (GRCm39) I95L probably benign Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTACTGAGAGAAGAGCTGTCGG -3'
(R):5'- ATTCTGCCGATCAAGGTCTTCC -3'

Sequencing Primer
(F):5'- TTGCCAGTCTTAGCAAGCAG -3'
(R):5'- GGTCTTCCTTCAGTAAACATATCTG -3'
Posted On 2016-04-15