Incidental Mutation 'R4918:Arfgef3'
ID378417
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene NameARFGEF family member 3
SynonymsB930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission 042520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4918 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18581839-18743949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18616890 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1258 (I1258F)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
Predicted Effect probably damaging
Transcript: ENSMUST00000019999
AA Change: I1258F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: I1258F

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: I1258F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.4935 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (116/117)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T G 17: 28,908,363 Q224P probably benign Het
Abca6 T A 11: 110,180,551 I1492F probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bnip1 C T 17: 26,783,551 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cntnap2 T C 6: 46,530,035 probably benign Het
Col9a1 T C 1: 24,237,258 I749T possibly damaging Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dhx40 G T 11: 86,804,391 H98N possibly damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpysl5 T G 5: 30,792,268 F461V probably damaging Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Esyt2 T C 12: 116,324,140 V226A probably benign Het
Fan1 A T 7: 64,373,538 probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fsip2 G A 2: 82,993,770 V6616I possibly damaging Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Golga4 C A 9: 118,558,145 S1445Y probably damaging Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ifi206 T A 1: 173,482,044 T129S possibly damaging Het
Jakmip1 G A 5: 37,091,275 R93Q probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt5 A T 15: 101,710,307 Y340N probably damaging Het
Krt90 T A 15: 101,562,479 H116L possibly damaging Het
Large2 A G 2: 92,366,107 probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mrps28 A G 3: 8,882,554 probably benign Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nckap1l A G 15: 103,483,613 N825S probably benign Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr353 A G 2: 36,890,332 I172T probably damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Olfr988 C T 2: 85,353,288 V213I probably benign Het
Pcdh20 A C 14: 88,467,668 L732R probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prpf18 T C 2: 4,637,170 D186G probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rbp3 T C 14: 33,955,411 Y439H probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Sulf1 A G 1: 12,818,496 D335G probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Thsd7a A C 6: 12,327,559 I1438S probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Trav6d-4 T C 14: 52,753,783 F95S probably damaging Het
Ttn T C 2: 76,759,254 T21219A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r69 T A 7: 85,406,759 M724L probably benign Het
Zeb2 A G 2: 44,996,882 I706T probably damaging Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R7934:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTTCCGCCGATCACTAG -3'
(R):5'- TCCAGAAGCCATATTCTCCCTG -3'

Sequencing Primer
(F):5'- CACTAGGTGATCCTGGCCAGATTG -3'
(R):5'- AGAAGCCATATTCTCCCTGCTTGAC -3'
Posted On2016-04-15