Incidental Mutation 'R0243:Ep400'
ID37846
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
MMRRC Submission 038481-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0243 (G1)
Quality Score109
Status Validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 110724407 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
Predicted Effect probably benign
Transcript: ENSMUST00000041558
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112435
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112436
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 98% (148/151)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T G 5: 63,898,463 Y181D probably benign Het
1110034G24Rik T C 2: 132,750,639 V202A probably benign Het
1700029H14Rik A G 8: 13,554,715 V196A possibly damaging Het
2410004B18Rik A G 3: 145,938,078 D7G probably damaging Het
2810474O19Rik T C 6: 149,326,241 Y262H probably damaging Het
Acap1 A G 11: 69,885,426 V249A probably damaging Het
Acat2 A T 17: 12,944,021 D313E probably benign Het
Actn4 T C 7: 28,905,398 T325A probably benign Het
Adamdec1 C T 14: 68,581,958 probably null Het
Adat2 A G 10: 13,553,293 T10A probably benign Het
Aff4 T A 11: 53,397,858 S400R possibly damaging Het
Agbl2 C T 2: 90,791,481 P104L possibly damaging Het
Alox12 G T 11: 70,242,716 T594K possibly damaging Het
Als2 C A 1: 59,215,387 K270N probably benign Het
Ankhd1 T A 18: 36,634,734 C1235S probably damaging Het
Ankrd24 T A 10: 81,634,944 I69N probably damaging Het
Aox4 G A 1: 58,213,076 V37I probably benign Het
Arfgap3 A G 15: 83,330,513 probably benign Het
Arhgef4 T A 1: 34,806,999 probably null Het
Asic1 C T 15: 99,698,617 probably benign Het
Atp8b5 A G 4: 43,366,057 N776S probably benign Het
Bbs7 A G 3: 36,605,734 I184T probably benign Het
Bbs9 A T 9: 22,514,001 H117L probably damaging Het
Bnip2 T C 9: 69,995,505 W10R probably damaging Het
Brd4 G T 17: 32,224,123 Q175K probably benign Het
Bysl A T 17: 47,606,896 V124E possibly damaging Het
Cadm3 A G 1: 173,346,573 probably benign Het
Cc2d2a T C 5: 43,696,638 probably benign Het
Ccdc134 G T 15: 82,140,946 E215D probably damaging Het
Celsr3 G T 9: 108,843,724 probably benign Het
Cntn5 T A 9: 9,781,775 D428V probably damaging Het
Cog1 A G 11: 113,656,995 probably benign Het
Col11a2 G T 17: 34,062,546 probably benign Het
Cyp4f13 G A 17: 32,924,969 probably benign Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Dffb T A 4: 153,965,378 K343* probably null Het
Dnah9 T A 11: 65,911,852 I224F possibly damaging Het
Dolk A T 2: 30,286,019 C5S probably benign Het
Ebf1 A T 11: 44,869,088 probably benign Het
Elac1 A G 18: 73,742,363 L199P probably damaging Het
Elmod1 A C 9: 53,935,547 probably benign Het
F10 A T 8: 13,048,196 N133I probably damaging Het
Fasn A G 11: 120,815,315 Y1068H probably benign Het
Fbxo24 T C 5: 137,624,557 E12G probably damaging Het
Fer G T 17: 64,078,946 L304F probably benign Het
Filip1 A C 9: 79,819,003 L778R probably damaging Het
Fli1 A T 9: 32,423,981 I385N probably benign Het
Fpgs A T 2: 32,692,494 L89* probably null Het
Gab2 T G 7: 97,299,241 I346R probably damaging Het
Gm10764 G A 10: 87,290,979 G83R unknown Het
Gpr83 G T 9: 14,864,842 C153F possibly damaging Het
Gtf3c3 A G 1: 54,403,536 L783P possibly damaging Het
Gys2 A G 6: 142,472,668 probably benign Het
Heatr9 C T 11: 83,513,338 V378I possibly damaging Het
Helz A T 11: 107,637,914 Y920F possibly damaging Het
Inpp5f A T 7: 128,695,183 Q459L probably damaging Het
Ints12 T C 3: 133,109,045 S338P probably benign Het
Kif13a T C 13: 46,791,351 T925A probably benign Het
Kif1a C T 1: 93,042,093 V1051I probably damaging Het
Kif7 T A 7: 79,699,560 H1119L possibly damaging Het
Kmt2d C T 15: 98,850,137 probably benign Het
Krt90 C T 15: 101,562,675 G51S possibly damaging Het
Krtap31-2 A T 11: 99,936,746 I135F possibly damaging Het
Lrp2 T C 2: 69,428,630 E4572G probably benign Het
Mapk8ip1 T C 2: 92,385,944 E493G probably damaging Het
Matk T G 10: 81,258,492 L28V probably benign Het
Mcc T A 18: 44,759,299 T83S probably benign Het
Mtch1 A T 17: 29,340,106 M204K possibly damaging Het
Muc4 T G 16: 32,765,746 C2622G possibly damaging Het
Myo5a G A 9: 75,186,123 probably null Het
Myoz3 T C 18: 60,578,951 Y185C probably damaging Het
Nnmt A G 9: 48,592,138 V196A probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nup214 T A 2: 31,998,057 probably benign Het
Olfr1261 T A 2: 89,993,806 F138I probably benign Het
Olfr1383 T C 11: 49,523,912 L63P probably damaging Het
Olfr169 T G 16: 19,566,294 E196D probably damaging Het
Pank3 T C 11: 35,781,716 probably benign Het
Parm1 A T 5: 91,594,294 N174Y possibly damaging Het
Pcgf2 A T 11: 97,692,418 probably null Het
Pclo A T 5: 14,775,420 K4661M unknown Het
Pcsk7 A C 9: 45,916,059 S375R probably damaging Het
Pdzrn4 G T 15: 92,770,319 S784I possibly damaging Het
Pex6 T A 17: 46,723,737 probably null Het
Pi4ka C T 16: 17,297,635 V1384M probably benign Het
Polr3f T A 2: 144,536,275 probably benign Het
Ppp2r3a A T 9: 101,212,284 V280E probably damaging Het
Prdm14 C T 1: 13,122,448 G356R probably damaging Het
Prepl A G 17: 85,065,038 probably null Het
Primpol T C 8: 46,599,814 D154G probably damaging Het
Ptchd4 A C 17: 42,503,416 H736P probably damaging Het
Rab11fip1 A G 8: 27,152,225 S849P probably damaging Het
Rap1gap T A 4: 137,719,351 D405E probably damaging Het
Rbm26 T C 14: 105,131,938 T686A probably benign Het
Rint1 A G 5: 23,816,932 probably benign Het
Rnasek G T 11: 70,238,440 Y62* probably null Het
Rnf17 T G 14: 56,482,084 N930K possibly damaging Het
Sap130 A G 18: 31,680,681 probably benign Het
Sectm1b T A 11: 121,055,785 I95F probably damaging Het
Sema4f A T 6: 82,939,466 I53N possibly damaging Het
Siglec1 T C 2: 131,085,476 T137A probably damaging Het
Six5 A C 7: 19,097,022 probably null Het
Slc22a30 A T 19: 8,345,357 I345N probably benign Het
Slc25a27 A T 17: 43,643,627 M316K probably benign Het
Slc2a8 A T 2: 32,980,104 probably benign Het
Snx1 G A 9: 66,101,326 probably benign Het
Spag17 A G 3: 100,085,368 T1727A probably benign Het
Spata20 T C 11: 94,481,646 D633G probably benign Het
Spock1 C T 13: 57,436,109 probably null Het
Sra1 A T 18: 36,675,706 Y291* probably null Het
Sspo C A 6: 48,493,186 P4520T probably damaging Het
Stat4 A G 1: 52,011,857 N25S probably benign Het
Tbx18 A T 9: 87,715,516 probably benign Het
Tctex1d2 A G 16: 32,426,887 D118G probably damaging Het
Tep1 T A 14: 50,846,987 I187F probably damaging Het
Tfap2b A T 1: 19,234,123 I368F probably damaging Het
Tmtc1 A T 6: 148,246,837 L711Q probably damaging Het
Tmx3 T A 18: 90,538,489 probably benign Het
Tnc G T 4: 63,970,420 T1803K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tpgs1 C T 10: 79,675,866 P281S probably benign Het
Trim45 A G 3: 100,929,844 R499G probably benign Het
Tulp3 A T 6: 128,325,958 Y299* probably null Het
Ube4a A T 9: 44,946,178 probably benign Het
Ubr3 T G 2: 69,951,405 S642R probably damaging Het
Vcpip1 A T 1: 9,747,206 Y317* probably null Het
Vmn1r115 G A 7: 20,844,402 T195I probably benign Het
Vmn1r226 G A 17: 20,687,577 V24I probably benign Het
Wdr41 C T 13: 95,017,406 A321V probably damaging Het
Wfdc5 T C 2: 164,178,835 N44D probably benign Het
Wnt7b C A 15: 85,558,902 probably null Het
Zfp108 T C 7: 24,261,783 S600P possibly damaging Het
Zfp385b A G 2: 77,415,728 probably null Het
Zfp395 T C 14: 65,386,480 S133P probably benign Het
Zfp407 T A 18: 84,558,711 M1426L probably damaging Het
Zfp641 T G 15: 98,289,127 N191T possibly damaging Het
Zfp687 T C 3: 95,011,553 S303G probably damaging Het
Zfp759 T A 13: 67,138,813 F143I possibly damaging Het
Zgrf1 G C 3: 127,615,446 E1690Q probably damaging Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 intron probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 intron probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
R7581:Ep400 UTSW 5 110756025 missense unknown
R7684:Ep400 UTSW 5 110697352 missense unknown
R7699:Ep400 UTSW 5 110696032 missense unknown
R7700:Ep400 UTSW 5 110696032 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Predicted Primers PCR Primer
(F):5'- AACTACTGGGCAGAACCACTGGAC -3'
(R):5'- ATTGTGGATGGCAGGCTGACAG -3'

Sequencing Primer
(F):5'- CTGCTTCAGTCTCAAAAGAATAGG -3'
(R):5'- GACAATAGTTTCCAGAATCAACCTG -3'
Posted On2013-05-23