Incidental Mutation 'R4919:Ncapd3'
ID378475
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Namenon-SMC condensin II complex, subunit D3
Synonyms4632407J06Rik, B130055D15Rik, 2810487N22Rik
MMRRC Submission 042521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4919 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27030175-27095315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27051775 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 459 (P459S)
Ref Sequence ENSEMBL: ENSMUSP00000083374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
Predicted Effect probably benign
Transcript: ENSMUST00000073127
AA Change: P459S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: P459S

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086198
AA Change: P459S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: P459S

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216677
AA Change: P459S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217311
Meta Mutation Damage Score 0.4042 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,288 D240G possibly damaging Het
Aplf T C 6: 87,630,064 D456G possibly damaging Het
Brd8 A G 18: 34,607,436 F445S probably damaging Het
Coro1b C T 19: 4,150,710 R214C possibly damaging Het
Dopey1 T A 9: 86,520,056 I1101K possibly damaging Het
Enpp1 A G 10: 24,648,085 V728A probably benign Het
Gosr1 T A 11: 76,734,566 probably null Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80 T A 2: 119,442,592 T468S probably damaging Het
Kcnab2 T C 4: 152,401,940 K134E probably damaging Het
Klhl17 C T 4: 156,233,887 V93I possibly damaging Het
Kmt2c G T 5: 25,314,395 P2239Q possibly damaging Het
Lnpep A G 17: 17,578,911 F161L probably damaging Het
Lrp1b T A 2: 40,647,234 I14F probably benign Het
Mbtd1 T A 11: 93,923,148 probably null Het
Musk A C 4: 58,366,899 I506L probably damaging Het
Mydgf C T 17: 56,176,953 V158I probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1175-ps A G 2: 88,323,648 V19A probably benign Het
Olfr1361 A T 13: 21,658,624 I233N possibly damaging Het
Olfr525 A T 7: 140,323,514 K272* probably null Het
Pnmt T A 11: 98,386,651 L7Q probably benign Het
Rerg T C 6: 137,056,144 I197V probably damaging Het
Sgo2a T C 1: 57,998,134 S13P probably damaging Het
Sim2 T C 16: 94,109,335 S199P probably benign Het
Smc1b T C 15: 85,117,104 probably benign Het
Spata7 T C 12: 98,648,453 S115P possibly damaging Het
Ssh2 A G 11: 77,425,320 T250A possibly damaging Het
Sv2a A G 3: 96,190,755 N558S probably benign Het
Tia1 T A 6: 86,424,323 probably benign Het
Tmem39a A G 16: 38,585,199 Y46C probably benign Het
Vmn2r2 A G 3: 64,117,157 S668P possibly damaging Het
Vwa1 C A 4: 155,770,600 A326S probably benign Het
Xpo6 A G 7: 126,152,943 M327T probably benign Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 27052353 missense probably benign
IGL00544:Ncapd3 APN 9 27063338 missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 27071824 missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 27071965 critical splice donor site probably null
IGL02073:Ncapd3 APN 9 27063316 missense probably benign 0.03
IGL02083:Ncapd3 APN 9 27051821 missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 27050328 missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27089302 missense probably benign 0.08
IGL02437:Ncapd3 APN 9 27063968 splice site probably benign
IGL02861:Ncapd3 APN 9 27069899 missense probably benign 0.00
IGL03202:Ncapd3 APN 9 27071715 splice site probably benign
IGL03219:Ncapd3 APN 9 27063873 splice site probably benign
IGL03252:Ncapd3 APN 9 27051449 missense probably damaging 1.00
pevensie UTSW 9 27086046 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 27056111 missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 27057883 missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 27064105 splice site probably benign
R0565:Ncapd3 UTSW 9 27087998 missense probably benign 0.00
R0601:Ncapd3 UTSW 9 27041507 missense probably benign 0.05
R0671:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0673:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0842:Ncapd3 UTSW 9 27037084 missense probably benign 0.01
R1178:Ncapd3 UTSW 9 27041421 missense probably benign
R1366:Ncapd3 UTSW 9 27057940 missense probably damaging 1.00
R1432:Ncapd3 UTSW 9 27069872 splice site probably benign
R1439:Ncapd3 UTSW 9 27087566 critical splice donor site probably null
R1532:Ncapd3 UTSW 9 27083360 nonsense probably null
R2131:Ncapd3 UTSW 9 27083346 missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 27088549 missense probably benign 0.01
R2238:Ncapd3 UTSW 9 27067024 missense probably benign
R2258:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2259:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2260:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2297:Ncapd3 UTSW 9 27041501 nonsense probably null
R2877:Ncapd3 UTSW 9 27044487 splice site probably null
R3612:Ncapd3 UTSW 9 27050357 missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 27052349 missense probably benign 0.00
R3791:Ncapd3 UTSW 9 27052635 missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27089383 splice site probably null
R4297:Ncapd3 UTSW 9 27052327 missense probably benign
R4299:Ncapd3 UTSW 9 27052327 missense probably benign
R4441:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27094615 missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27094742 unclassified probably benign
R4790:Ncapd3 UTSW 9 27051850 missense probably benign 0.00
R4835:Ncapd3 UTSW 9 27086046 missense probably damaging 1.00
R4928:Ncapd3 UTSW 9 27071735 nonsense probably null
R4939:Ncapd3 UTSW 9 27063869 critical splice donor site probably null
R4980:Ncapd3 UTSW 9 27063295 missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 27071766 missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 27051719 missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 27088053 small deletion probably benign
R5656:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5840:Ncapd3 UTSW 9 27094758 missense probably benign 0.00
R5900:Ncapd3 UTSW 9 27066969 missense probably benign 0.26
R6093:Ncapd3 UTSW 9 27056158 missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 27063982 missense probably benign 0.00
R6249:Ncapd3 UTSW 9 27088053 small deletion probably benign
R6428:Ncapd3 UTSW 9 27052664 splice site probably null
R6432:Ncapd3 UTSW 9 27044509 missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 27063416 missense probably benign 0.03
R6459:Ncapd3 UTSW 9 27051755 missense probably benign 0.00
R6567:Ncapd3 UTSW 9 27067004 missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 27087556 missense probably benign
R6862:Ncapd3 UTSW 9 27030809 missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 27050359 missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 27069958 missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 27067019 missense probably benign 0.01
R7541:Ncapd3 UTSW 9 27067040 missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 27071848 missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7815:Ncapd3 UTSW 9 27063440 nonsense probably null
R7876:Ncapd3 UTSW 9 27045223 critical splice donor site probably null
R7913:Ncapd3 UTSW 9 27048226 nonsense probably null
R7959:Ncapd3 UTSW 9 27045223 critical splice donor site probably null
R7994:Ncapd3 UTSW 9 27048226 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGCGCCTTACTCAGTG -3'
(R):5'- CCTTAACAAAGAATGGTCCATTTGC -3'

Sequencing Primer
(F):5'- TTACTCAGTGCCGGACCC -3'
(R):5'- AAGAATGGTCCATTTGCAGTTTTTG -3'
Posted On2016-04-15