Mutagenetix > Incidental Mutations

Incidental Mutation 'R4919:3425401B19Rik'

378488

Institutional Source

Beutler Lab

Gene Symbol

3425401B19Rik

Ensembl Gene

ENSMUSG00000071540

Gene Name

RIKEN cDNA 3425401B19 gene

Synonyms

MMRRC Submission

042521-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R4919 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32659119-32685293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32663288 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 240 (D240G)

Ref Sequence

ENSEMBL: ENSMUSP00000093741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096038]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096038
AA Change: D240G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: D240G

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
low complexity region	162	175	N/A	INTRINSIC
low complexity region	386	399	N/A	INTRINSIC
low complexity region	587	602	N/A	INTRINSIC
low complexity region	605	624	N/A	INTRINSIC
low complexity region	728	744	N/A	INTRINSIC
low complexity region	1002	1015	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1147	1158	N/A	INTRINSIC
low complexity region	1161	1176	N/A	INTRINSIC
Pfam:DUF4585	1251	1322	6.5e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226958

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aplf	T	C	6: 87,630,064	D456G	possibly damaging	Het
Brd8	A	G	18: 34,607,436	F445S	probably damaging	Het
Coro1b	C	T	19: 4,150,710	R214C	possibly damaging	Het
Dopey1	T	A	9: 86,520,056	I1101K	possibly damaging	Het
Enpp1	A	G	10: 24,648,085	V728A	probably benign	Het
Gosr1	T	A	11: 76,734,566		probably null	Het
Grhl3	T	A	4: 135,559,104	K89*	probably null	Het
Ino80	T	A	2: 119,442,592	T468S	probably damaging	Het
Kcnab2	T	C	4: 152,401,940	K134E	probably damaging	Het
Klhl17	C	T	4: 156,233,887	V93I	possibly damaging	Het
Kmt2c	G	T	5: 25,314,395	P2239Q	possibly damaging	Het
Lnpep	A	G	17: 17,578,911	F161L	probably damaging	Het
Lrp1b	T	A	2: 40,647,234	I14F	probably benign	Het
Mbtd1	T	A	11: 93,923,148		probably null	Het
Musk	A	C	4: 58,366,899	I506L	probably damaging	Het
Mydgf	C	T	17: 56,176,953	V158I	probably damaging	Het
Ncapd3	C	T	9: 27,051,775	P459S	possibly damaging	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr1175-ps	A	G	2: 88,323,648	V19A	probably benign	Het
Olfr1361	A	T	13: 21,658,624	I233N	possibly damaging	Het
Olfr525	A	T	7: 140,323,514	K272*	probably null	Het
Pnmt	T	A	11: 98,386,651	L7Q	probably benign	Het
Rerg	T	C	6: 137,056,144	I197V	probably damaging	Het
Sgo2a	T	C	1: 57,998,134	S13P	probably damaging	Het
Sim2	T	C	16: 94,109,335	S199P	probably benign	Het
Smc1b	T	C	15: 85,117,104		probably benign	Het
Spata7	T	C	12: 98,648,453	S115P	possibly damaging	Het
Ssh2	A	G	11: 77,425,320	T250A	possibly damaging	Het
Sv2a	A	G	3: 96,190,755	N558S	probably benign	Het
Tia1	T	A	6: 86,424,323		probably benign	Het
Tmem39a	A	G	16: 38,585,199	Y46C	probably benign	Het
Vmn2r2	A	G	3: 64,117,157	S668P	possibly damaging	Het
Vwa1	C	A	4: 155,770,600	A326S	probably benign	Het
Xpo6	A	G	7: 126,152,943	M327T	probably benign	Het

Other mutations in 3425401B19Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:3425401B19Rik	APN	14	32660916	missense	probably benign	0.18
IGL00844:3425401B19Rik	APN	14	32662999	nonsense	probably null
IGL01292:3425401B19Rik	APN	14	32660874	missense	probably benign	0.18
IGL01295:3425401B19Rik	APN	14	32661936	missense	possibly damaging	0.53
IGL01457:3425401B19Rik	APN	14	32660951	missense	probably benign
IGL01470:3425401B19Rik	APN	14	32660457	missense	possibly damaging	0.53
IGL01612:3425401B19Rik	APN	14	32660031	missense	possibly damaging	0.53
IGL01974:3425401B19Rik	APN	14	32659805	missense	possibly damaging	0.85
IGL02095:3425401B19Rik	APN	14	32661626	missense	probably benign	0.33
IGL02138:3425401B19Rik	APN	14	32662715	missense	possibly damaging	0.83
IGL02178:3425401B19Rik	APN	14	32662461	missense	possibly damaging	0.83
IGL02245:3425401B19Rik	APN	14	32659815	missense	probably benign	0.03
IGL02529:3425401B19Rik	APN	14	32661233	missense	probably benign
IGL03401:3425401B19Rik	APN	14	32662266	nonsense	probably null
PIT4515001:3425401B19Rik	UTSW	14	32661111	nonsense	probably null
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0320:3425401B19Rik	UTSW	14	32662614	missense	probably benign	0.19
R0519:3425401B19Rik	UTSW	14	32662962	missense	possibly damaging	0.92
R0551:3425401B19Rik	UTSW	14	32662641	missense	probably benign	0.03
R0759:3425401B19Rik	UTSW	14	32662497	missense	possibly damaging	0.93
R0831:3425401B19Rik	UTSW	14	32662271	missense	probably benign	0.01
R1124:3425401B19Rik	UTSW	14	32662082	missense	possibly damaging	0.53
R1346:3425401B19Rik	UTSW	14	32660814	missense	probably benign	0.07
R1997:3425401B19Rik	UTSW	14	32660048	missense	possibly damaging	0.71
R2055:3425401B19Rik	UTSW	14	32662551	missense	probably benign
R2212:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R2416:3425401B19Rik	UTSW	14	32663834	missense	probably benign	0.04
R2441:3425401B19Rik	UTSW	14	32663492	missense	possibly damaging	0.53
R2513:3425401B19Rik	UTSW	14	32661852	missense	possibly damaging	0.53
R3414:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R3800:3425401B19Rik	UTSW	14	32663068	missense	possibly damaging	0.83
R3809:3425401B19Rik	UTSW	14	32663693	missense	possibly damaging	0.96
R4166:3425401B19Rik	UTSW	14	32660955	missense	possibly damaging	0.53
R4581:3425401B19Rik	UTSW	14	32661871	missense	possibly damaging	0.73
R4721:3425401B19Rik	UTSW	14	32663150	missense	probably benign	0.01
R4769:3425401B19Rik	UTSW	14	32660217	missense	probably benign	0.32
R4809:3425401B19Rik	UTSW	14	32662631	missense	probably benign	0.19
R4925:3425401B19Rik	UTSW	14	32663180	missense	possibly damaging	0.86
R4972:3425401B19Rik	UTSW	14	32661404	missense	possibly damaging	0.73
R5068:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5069:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5070:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5258:3425401B19Rik	UTSW	14	32663309	missense	probably damaging	0.98
R5435:3425401B19Rik	UTSW	14	32661456	missense	probably benign	0.18
R5549:3425401B19Rik	UTSW	14	32663036	missense	possibly damaging	0.68
R5678:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5680:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5872:3425401B19Rik	UTSW	14	32660352	missense	possibly damaging	0.73
R5896:3425401B19Rik	UTSW	14	32661675	nonsense	probably null
R5940:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6044:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R6136:3425401B19Rik	UTSW	14	32662282	missense	possibly damaging	0.70
R6277:3425401B19Rik	UTSW	14	32663694	missense	possibly damaging	0.86
R6385:3425401B19Rik	UTSW	14	32661279	missense	probably benign	0.01
R6728:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6984:3425401B19Rik	UTSW	14	32661980	missense	probably benign	0.00
R7047:3425401B19Rik	UTSW	14	32660174	missense	possibly damaging	0.89
R7249:3425401B19Rik	UTSW	14	32663314	missense	possibly damaging	0.73
R7493:3425401B19Rik	UTSW	14	32663300	missense	possibly damaging	0.96
R7575:3425401B19Rik	UTSW	14	32662632	missense	probably benign	0.03
R7742:3425401B19Rik	UTSW	14	32662757	missense	possibly damaging	0.68
R7747:3425401B19Rik	UTSW	14	32663069	missense	possibly damaging	0.83
R7784:3425401B19Rik	UTSW	14	32659840	missense	probably benign	0.00
X0025:3425401B19Rik	UTSW	14	32662469	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGGTGGTTTCAGCAATGTCC -3'
(R):5'- CTCAATCTTGTGACAGCCGG -3'

Sequencing Primer
(F):5'- GGTGGTTTCAGCAATGTCCTTTCTC -3'
(R):5'- CCCAGAAAGTGGTGTCAACTTCTG -3'

Posted On

2016-04-15