Mutagenetix > Incidental Mutation

Incidental Mutation 'R4920:Slc9a2'

378496

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

042522-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R4920 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40755718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 480 (I480V)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231]

AlphaFold

Q3ZAS0

Predicted Effect

probably benign
Transcript: ENSMUST00000027231
AA Change: I480V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I480V

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192294

Meta Mutation Damage Score

0.2052

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 87.9%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700092K14Rik	A	T	11: 114,199,045		noncoding transcript	Het
Adcy4	C	T	14: 55,779,029	D322N	probably damaging	Het
Apbb1ip	A	G	2: 22,819,684	D51G	unknown	Het
Arntl	A	G	7: 113,285,114	T120A	probably damaging	Het
Brca1	A	T	11: 101,524,959	V783D	probably damaging	Het
Ccdc141	T	C	2: 77,168,563	D58G	probably damaging	Het
Ccr9	G	T	9: 123,779,439	G62V	probably damaging	Het
Ces2b	T	C	8: 104,836,906	Y422H	probably benign	Het
Cpa4	T	C	6: 30,568,463		probably null	Het
Dennd3	A	G	15: 73,540,725	H412R	probably benign	Het
Dpy19l3	A	T	7: 35,708,042		probably benign	Het
Dtwd2	G	T	18: 49,698,440	R167S	possibly damaging	Het
Dync1i2	G	A	2: 71,247,324	R243Q	probably damaging	Het
Ear2	G	A	14: 44,103,125	G80E	probably damaging	Het
Fam171b	A	G	2: 83,880,359	K792E	possibly damaging	Het
Fam83b	G	A	9: 76,491,868	T651I	probably benign	Het
Fcrl5	T	G	3: 87,444,173	F243V	probably damaging	Het
Galntl6	T	C	8: 58,427,773	I115M	probably damaging	Het
Glrx3	A	G	7: 137,464,130	D163G	probably null	Het
Gm13089	T	C	4: 143,699,283	D30G	probably benign	Het
Gm14488	A	T	2: 30,715,032		noncoding transcript	Het
Gm973	T	C	1: 59,627,566	S683P	probably benign	Het
Grhl3	T	A	4: 135,559,104	K89*	probably null	Het
Gsdmd	T	C	15: 75,864,357	S112P	probably damaging	Het
Ighv14-3	A	G	12: 114,060,257	V6A	probably benign	Het
Lca5l	T	A	16: 96,178,835	S32C	probably damaging	Het
Lrba	T	A	3: 86,664,458	Y260*	probably null	Het
Lyst	T	C	13: 13,647,060	S1340P	possibly damaging	Het
Mfsd13a	T	G	19: 46,367,216	F59V	probably damaging	Het
Nek10	T	A	14: 14,860,986	L513M	possibly damaging	Het
Noa1	T	C	5: 77,306,487		probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Papd4	G	A	13: 93,186,325	Q39*	probably null	Het
Pgm2	C	T	4: 99,986,733	T571M	probably damaging	Het
Rfc1	C	A	5: 65,287,928	V460F	probably damaging	Het
Rrn3	A	G	16: 13,790,639	D182G	probably benign	Het
Sap25	T	A	5: 137,642,245		probably benign	Het
Smo	T	C	6: 29,759,594	S642P	probably damaging	Het
Tbc1d22a	A	C	15: 86,311,748	I307L	probably benign	Het
Ubr3	A	G	2: 69,952,868	Q716R	probably benign	Het
Vmn2r96	A	G	17: 18,582,656	E276G	probably benign	Het
Zfp189	G	A	4: 49,529,302	C135Y	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTCCATTTTGGGCATCTGG -3'
(R):5'- ATGAAGAGTCTGCCTCCCATC -3'

Sequencing Primer
(F):5'- GTCTTATGAAAATCAGACATCTGTGG -3'
(R):5'- TCCCATCACAGACCTTCCTGAG -3'

Posted On

2016-04-15