Incidental Mutation 'R4920:Zfp189'
ID378505
Institutional Source Beutler Lab
Gene Symbol Zfp189
Ensembl Gene ENSMUSG00000039634
Gene Namezinc finger protein 189
SynonymsC430015I23Rik
MMRRC Submission 042522-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4920 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49521176-49531517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49529302 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 135 (C135Y)
Ref Sequence ENSEMBL: ENSMUSP00000103324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042964] [ENSMUST00000107696]
Predicted Effect probably damaging
Transcript: ENSMUST00000042964
AA Change: C135Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036663
Gene: ENSMUSG00000039634
AA Change: C135Y

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107696
AA Change: C135Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103324
Gene: ENSMUSG00000039634
AA Change: C135Y

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Meta Mutation Damage Score 0.7832 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kruppel-like zinc finger proteins such as ZNF189 contain a conserved stretch of 7 amino acids that connects a variable number of DNA-binding zinc finger repeats of the cys(2)his(2) (C2H2) type (summarized by Odeberg et al., 1998 [PubMed 9653648]). Approximately 30% of human Kruppel-like zinc finger proteins contain an N-terminal Kruppel-associated box (KRAB) domain. The KRAB domain consists of approximately 75 amino acids that may be subdivided into an A box, which is present in every KRAB domain and is essential for transcriptional repression, and a B box, which is not always present.[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092K14Rik A T 11: 114,199,045 noncoding transcript Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Apbb1ip A G 2: 22,819,684 D51G unknown Het
Arntl A G 7: 113,285,114 T120A probably damaging Het
Brca1 A T 11: 101,524,959 V783D probably damaging Het
Ccdc141 T C 2: 77,168,563 D58G probably damaging Het
Ccr9 G T 9: 123,779,439 G62V probably damaging Het
Ces2b T C 8: 104,836,906 Y422H probably benign Het
Cpa4 T C 6: 30,568,463 probably null Het
Dennd3 A G 15: 73,540,725 H412R probably benign Het
Dpy19l3 A T 7: 35,708,042 probably benign Het
Dtwd2 G T 18: 49,698,440 R167S possibly damaging Het
Dync1i2 G A 2: 71,247,324 R243Q probably damaging Het
Ear2 G A 14: 44,103,125 G80E probably damaging Het
Fam171b A G 2: 83,880,359 K792E possibly damaging Het
Fam83b G A 9: 76,491,868 T651I probably benign Het
Fcrl5 T G 3: 87,444,173 F243V probably damaging Het
Galntl6 T C 8: 58,427,773 I115M probably damaging Het
Glrx3 A G 7: 137,464,130 D163G probably null Het
Gm13089 T C 4: 143,699,283 D30G probably benign Het
Gm14488 A T 2: 30,715,032 noncoding transcript Het
Gm973 T C 1: 59,627,566 S683P probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Gsdmd T C 15: 75,864,357 S112P probably damaging Het
Ighv14-3 A G 12: 114,060,257 V6A probably benign Het
Lca5l T A 16: 96,178,835 S32C probably damaging Het
Lrba T A 3: 86,664,458 Y260* probably null Het
Lyst T C 13: 13,647,060 S1340P possibly damaging Het
Mfsd13a T G 19: 46,367,216 F59V probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Noa1 T C 5: 77,306,487 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Papd4 G A 13: 93,186,325 Q39* probably null Het
Pgm2 C T 4: 99,986,733 T571M probably damaging Het
Rfc1 C A 5: 65,287,928 V460F probably damaging Het
Rrn3 A G 16: 13,790,639 D182G probably benign Het
Sap25 T A 5: 137,642,245 probably benign Het
Slc9a2 A G 1: 40,755,718 I480V probably benign Het
Smo T C 6: 29,759,594 S642P probably damaging Het
Tbc1d22a A C 15: 86,311,748 I307L probably benign Het
Ubr3 A G 2: 69,952,868 Q716R probably benign Het
Vmn2r96 A G 17: 18,582,656 E276G probably benign Het
Other mutations in Zfp189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02075:Zfp189 APN 4 49522445 missense probably damaging 0.98
R1754:Zfp189 UTSW 4 49529342 missense possibly damaging 0.87
R1848:Zfp189 UTSW 4 49529266 missense probably benign 0.01
R1868:Zfp189 UTSW 4 49529283 missense possibly damaging 0.90
R1903:Zfp189 UTSW 4 49529511 nonsense probably null
R2247:Zfp189 UTSW 4 49530393 missense possibly damaging 0.95
R2889:Zfp189 UTSW 4 49521547 start gained probably benign
R4389:Zfp189 UTSW 4 49529934 missense probably damaging 1.00
R4659:Zfp189 UTSW 4 49530342 missense probably benign 0.33
R4704:Zfp189 UTSW 4 49530081 missense probably damaging 0.98
R4840:Zfp189 UTSW 4 49529984 missense probably damaging 1.00
R5011:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5013:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5522:Zfp189 UTSW 4 49529739 nonsense probably null
R5639:Zfp189 UTSW 4 49530153 missense probably benign 0.01
R6814:Zfp189 UTSW 4 49529026 missense probably damaging 0.99
R7372:Zfp189 UTSW 4 49530417 missense possibly damaging 0.95
R7491:Zfp189 UTSW 4 49521569 missense probably benign 0.06
R7680:Zfp189 UTSW 4 49521547 start gained probably benign
R7800:Zfp189 UTSW 4 49529367 missense possibly damaging 0.95
R8023:Zfp189 UTSW 4 49530312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTAGCGAAACCTTTGAAC -3'
(R):5'- GAGCTCCGACTGAAACTCTTTC -3'

Sequencing Primer
(F):5'- AGCGAAACCTTTGAACTTGTTGG -3'
(R):5'- CCACAGTCACTGCATTTATGGGG -3'
Posted On2016-04-15