Incidental Mutation 'R4920:Glrx3'
ID378516
Institutional Source Beutler Lab
Gene Symbol Glrx3
Ensembl Gene ENSMUSG00000031068
Gene Nameglutaredoxin 3
SynonymsPKC interacting cousin of thioredoxin, Txnl2, PICOT
MMRRC Submission 042522-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4920 (G1)
Quality Score180
Status Validated
Chromosome7
Chromosomal Location137437614-137468594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137464130 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000148144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064404] [ENSMUST00000209696] [ENSMUST00000211496] [ENSMUST00000211769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064404
AA Change: D288G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066621
Gene: ENSMUSG00000031068
AA Change: D288G

DomainStartEndE-ValueType
Pfam:Phosducin 6 102 6.3e-10 PFAM
Pfam:DIM1 13 112 4.5e-9 PFAM
Pfam:Thioredoxin 15 117 1.2e-21 PFAM
Pfam:Glutaredoxin 148 212 2.9e-19 PFAM
Pfam:Glutaredoxin 250 314 1.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209696
AA Change: D163G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211496
AA Change: D288G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211769
Meta Mutation Damage Score 0.9419 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality during late organogenesis and early fetal development. Mice heterozygous for this gene trapped allele exhibit increased response to cardiac injury and decreased cardiac muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092K14Rik A T 11: 114,199,045 noncoding transcript Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Apbb1ip A G 2: 22,819,684 D51G unknown Het
Arntl A G 7: 113,285,114 T120A probably damaging Het
Brca1 A T 11: 101,524,959 V783D probably damaging Het
Ccdc141 T C 2: 77,168,563 D58G probably damaging Het
Ccr9 G T 9: 123,779,439 G62V probably damaging Het
Ces2b T C 8: 104,836,906 Y422H probably benign Het
Cpa4 T C 6: 30,568,463 probably null Het
Dennd3 A G 15: 73,540,725 H412R probably benign Het
Dpy19l3 A T 7: 35,708,042 probably benign Het
Dtwd2 G T 18: 49,698,440 R167S possibly damaging Het
Dync1i2 G A 2: 71,247,324 R243Q probably damaging Het
Ear2 G A 14: 44,103,125 G80E probably damaging Het
Fam171b A G 2: 83,880,359 K792E possibly damaging Het
Fam83b G A 9: 76,491,868 T651I probably benign Het
Fcrl5 T G 3: 87,444,173 F243V probably damaging Het
Galntl6 T C 8: 58,427,773 I115M probably damaging Het
Gm13089 T C 4: 143,699,283 D30G probably benign Het
Gm14488 A T 2: 30,715,032 noncoding transcript Het
Gm973 T C 1: 59,627,566 S683P probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Gsdmd T C 15: 75,864,357 S112P probably damaging Het
Ighv14-3 A G 12: 114,060,257 V6A probably benign Het
Lca5l T A 16: 96,178,835 S32C probably damaging Het
Lrba T A 3: 86,664,458 Y260* probably null Het
Lyst T C 13: 13,647,060 S1340P possibly damaging Het
Mfsd13a T G 19: 46,367,216 F59V probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Noa1 T C 5: 77,306,487 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Papd4 G A 13: 93,186,325 Q39* probably null Het
Pgm2 C T 4: 99,986,733 T571M probably damaging Het
Rfc1 C A 5: 65,287,928 V460F probably damaging Het
Rrn3 A G 16: 13,790,639 D182G probably benign Het
Sap25 T A 5: 137,642,245 probably benign Het
Slc9a2 A G 1: 40,755,718 I480V probably benign Het
Smo T C 6: 29,759,594 S642P probably damaging Het
Tbc1d22a A C 15: 86,311,748 I307L probably benign Het
Ubr3 A G 2: 69,952,868 Q716R probably benign Het
Vmn2r96 A G 17: 18,582,656 E276G probably benign Het
Zfp189 G A 4: 49,529,302 C135Y probably damaging Het
Other mutations in Glrx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Glrx3 APN 7 137452713 missense probably damaging 1.00
IGL02435:Glrx3 APN 7 137461396 missense possibly damaging 0.61
F5770:Glrx3 UTSW 7 137459153 missense probably benign
R0347:Glrx3 UTSW 7 137437701 missense unknown
R0359:Glrx3 UTSW 7 137453485 missense possibly damaging 0.80
R1270:Glrx3 UTSW 7 137453414 missense probably benign 0.02
R3692:Glrx3 UTSW 7 137459117 splice site probably benign
R4909:Glrx3 UTSW 7 137445036 missense probably damaging 1.00
R5509:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R6831:Glrx3 UTSW 7 137459222 missense possibly damaging 0.76
R7200:Glrx3 UTSW 7 137464436 missense possibly damaging 0.81
R7347:Glrx3 UTSW 7 137459286 missense possibly damaging 0.83
R7356:Glrx3 UTSW 7 137452724 missense probably damaging 0.98
R7481:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R7660:Glrx3 UTSW 7 137459225 missense probably damaging 1.00
R7685:Glrx3 UTSW 7 137459191 missense probably damaging 0.98
R8147:Glrx3 UTSW 7 137463007 missense probably benign 0.00
V7581:Glrx3 UTSW 7 137459153 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGTCCCCATGGCTTTACAG -3'
(R):5'- TCCCATCAGACCCTGTGAAC -3'

Sequencing Primer
(F):5'- CTTTACAGCAGGCTTCCTAGAGG -3'
(R):5'- GCGCACGCCTTTAATCCCAG -3'
Posted On2016-04-15